skinnbyxa--->

Ebba  (ebbsen_s@hotmail.com) om skolfotodagen wiihoo:
vart har du köpt idina skinnbyxor ? grymt snygga ! :D
svara gärna i ett inlägg eller på mailen :)
IP: 90.227.19.179

heyhey Ebba!
för det första vill jag börja med att säga tack!! o som svar på din fråga,
jag har köpt dom på bubbleroom.se lääänk häär--> http://www.bubbleroom.se/tjej/byxor/byxa-74-cm-svart-7347

p.s mät noga o se så att du får rätt storlek, länken är till de byxor som är 74 cm, ja har 79 cm på min

stor kram
//Erika


tack pappa massor!

tack pappi för världens grymaste photoshop<3

ni kan räkna me att det blir en ny nice header så fort allt är installerat o ja har lärt mej,...
ingen vet hur lång tid det tar men när ja väl har kommit igång, så är ja ostoppbar xD

//Erika

skolfotodagen wiihoo

home from school, dagen va chill.. skolfoto..
vet inte riktigt hur det slutade men aja, det får vi se i katalogen.
ska ta o äta lite flingor nu, sen baka kaka till söta vendla som fyller år imån
o får fira sin födelsedag på den otroligtmysigagoagladasoligavarma hajekn imån, grattis grattis grattis!
 hästarna ska ridas sen me, går ut o stallet kl.17.30 o sen ride rja tre ponnysar, pappi rider carro
hörs sen, min mage knorrar xd

dagen outfit va ungefär detta:

fast me ett kors i örat, nya klackarna o en slapp toffs o lockigt hår...

//Erika

argargarg o lite irriterad

vart mycket kring de där att "ooh, alla som har en fin/dyr häst är snobbar" eller " allt som krävs är att man kämpar, o att man lägger ner svett,skratt o tårar i allt man gör i stallet"

Ja, det är helt sant, man måste lägga ner mycket tid,skratt,tårar o allt det där för att lyckas, för att ta sej frammåt.. så långt håller ja me. Men när folk börjar säga saker som ja " åh hon är så snobbig för hon har en kingsland tröja" eller "man ska kämpa upp sina hästar själva, för annars är man sååå dålig" " alla som köper 'färdiga' hästar är dåliga för dom kan inte utbilda sina hästar själva" " får allting på ett silverfat" o "dom gör ALLT det här o köper alla fina dyra hästar BARA för ROSETTERNA"
då blir jag faktiskt arg
, för hur fasen vet DU, du ,du ,du o ni bakom era skärmar, hemme i era hus, ute i erat stall,framför iphonen,på tävlingsplatsen.. hur MYCKET tid,tårar o jobb en människa har lagt på sina hästar ? hur vet NI att dom inte sitter o tragglar dag ut o dag in i sin paddock 2,5 timma om dagen på samma häst? hur vet NI fall dom får allting på ett "silverfat"? O en annan sak, ja vet.. det är UNDERBAR när man tar upp en häst själv, när man är den första som gör allting me denna hästen, när alla framgångar är nått man skapat själva, för första gången, tillsammans- super kul
MEN är man DÅLIG bara för att man får en fin dyr häst? är man verkligen det? för att tävla msv,msvA o SM så krävs det ändå LITE, ialla fall i vanliga fall.. så DU/ni/din mamma/din syster/din vän, ska INTE tro att alla dessa tjejer o killar på hög nivå, med fina hästar är DÅLIGA, absolut INTE!
o det känns skönt, det känns som ett stöd o det känns som nått man alltid kan luta sej mot, att säga" allt som behövs för att nå toppen, för att komma långt med din häst är att ni kämpar", sorry, men den bittra sanningen är att, det är inte alltid det räcker...
om du har en ponny/häst som verkligen INTE vILL hoppa,rida gymkhana,terräng, ja vad ni nu vill göra- så spelar det ingen roll hur duktig du är, hur mycket du kämpar, hur mycket du vill o hur mycke tyd du lägger, för hästen VILL INTE. o då är det kört, tyvärr.
o en sak till, sen när alla har kämpat upp sina hästar till höga klasser, stora mål,msv B,msv A o SM, va ska vi göra med dom då? ställa dom i en stor hage o bara, sorry Pluto men nu är du så bra, så ingen vill ha dej för det nya modet är att kämpa upp sina hästar själva, så bye!
är det en good idea? tror inte de va
o den som för CHANSEN att få en dyr fin utbildad häst som kan gå det stora klasserna, Sm... ska dom TACKA NEJ för att det är lixom nästan pinsamt för att man inte gör jobbret själv!? när folk viskar o säger " oo hon är så snobbig o rik, kolla va bortskämd o dum hon är- hon har ju en ponny som går msv A o titta på animokavajen, ush vilken snobb" det är ju en SKANDAL!

ALLA ÄR DUKTIGA, ALLA KÄMPAR, BARA OLIKA MYCKET,ALLA VILL,BARA OLIKA MYCKET, ALLA KAN,IIINGEN ÄR DÅLIG FÖR ATT DOM HAR EN HÄST SOM GÅR HÖGRE KLASSR EN LISAS, O LISA ÄR INTE SÄMRE FÖR ATT HENNES INTE HOPPAR LIKA HÖGT, tänk på det, innan ni dämmer nån
 
detta är mina åsikter, vad tycker NI?
kram ERIKA

school,rida,rida...

trökig Erika.. hmm
aja, fy på mej, men har mycket o göra..
hästarna va finisar idag! Kakan va lugn, gick stdaigt på tygeln o jobbade bra, harry va lite stark o pigg eftersom ja red me dressyrspöt.. men gick fint i form på slutet..
efter ja ridit storponnysarna så åt jag lite o bytte om från stall till bandykläder..
spela me  goa laget till 19.30, sen hem me Lottataxin o red Carro me eve o jacky.. emma o sin nya fina storis, som btw är lillsyrra till Carro :D o så matilda o sin big horse.. Carro gick fint, förutom de att hon glömmer av hur man fattar galopp xd men men, hon lär väl sej nån gång när hon blir äldre o mer erfaren, hon är ju ändå bara 11... xD

har tittat lite på true talent nu, o det är bara för att våran TV är såååå grym!  TT började kl.20.00.. ja går in från stallet o trycker på PAUS, den pausar o ja kan trycka på play när ja kommer in o allt är som valig, såå grymt!
målade mina naglar lite snyggt o rött inför skolfotot imån... huuuh
o pluggat franska.. ska kunna böja ordet har lite hit o dit
J'ai
Tu as
il a
elle a
nous avons
vous evez
ils ont
elles ont

nice va? ;)
ska ta o hoppa in i duschen nu, o fixxa lite inlägg inför imån.. så vi hörs

//Erika

Sista inlägger för idag...

Nu ska jag gå o lägga mej, är ju rätt sjuk o har ont i hela kroppen, så med detta säger jag god natt! /Emma

Mot stallet!

Ombytt o klar, väntar bara på min mammsi :)

Va även hos läkarn idag, för att kolla upp mitt knä , (om ni kommer ihåg från AW i skåne?) haha, de läker v sej självt som tur e ! Men däremot har ja bihålesinflammation! :(

Jätte tråkit, plus mega ont i öronen...Så fick kortison spray och Antibiotika!
Blir nog bra snart ;)

Hörs sen!



Vinter bild me Conny<3


/emma

nice dag i skolan

hemma efter en kort lång dag, rätt trökiga lektioner.. fast så äre väl alltid..?
friendsen va grymma iaf, men så äre väl alltid...?
så nu blire lite bloggning, en macka o sen ut direkt till stallet o rida mina överfina pållar
rider två, sen åker ja till innebandyn, som börjar idag, wiiiiihiooo
rider en pålle till när ja kmr hem, me eve o jackson.. så

vi får höras sen, <3

//Erika

saknar denna sjukt söta underbara tjejen, så grymgrymt mycket!

skoolan now yeeah

ni glömmer väl inte tävlingen? o veckans fråga? om ni har gjort de, checka NU

go'morron allihopa, kl är 07.30... jag e fiixxad,o ska ta o käka some frukost,sen ---> bussen
har en kort dag idag, rida 3-4 hästar o innebande.. yepp den börjar idag!
va ett tag sen ja träffa alla, så ska bli nice o se dom igen.. HIBK<3

oops.. klockan tickar.. hörs när ja kmr hem, eller nått sånt
bye!


du, ja tänker på dej dag o natt.... tänker du på mej?

boringboring

Erika= sjukligt tråkig... I know
men ahr haft much to do idag... hästarna va GRYMMA, verkligen helt grymma!
tror nog aldrig att harry har gått så fint förut, underbart!

me and my mum har tittat på hollywood fruar me, lätt ett av mina favvo program, dom är ju sä
galet blonda, men loves Montazami! grymt go är hon xd
men jag hade tänkt att fortsätta vara tråkig, o dra mej till sängs, efter en varm dusch.. så vi hörs tomorrow!

tröökiga kramar
/ERika

Veckans fråga!




Vad tycker ni om att rida med graman?


Själv tkr jag att det är inget fel i det!
Alla hästar/ponnys går inte självmant i form, som Cooper tillexempel.
Och därför rider jag med graman så att han verkligen ska få trampa under sej och jobba!
Och detta handlar inte om att tvinga ner hästen i form , för de gör jag inte.
Jag länger ut gramanen medans jag rider.
Och sedan kan man ju ta av den , brukar jag göra, o då är han riktigt mjuk o fin!


Vad tycker ni?
Vill verkligen veta vad ni tycker och vad ni har för åsikter!
Kommenterar ni riktigt bra så bjuder ja o Erika på ngt här på bloggen som ni INTE vill missa... ;)





/emma





Läxoor..

Precis gjort klart min svenska och matte! (Duktig jag...)

Mamma tog hand om cooper idag, o i morn blire nog ett markarbetspass :)

Snart kommer en fråga som ALLA borde svara på ....så håll utkik!




Jag o Ozziboi<3



/emma

kl.21.00 är ja tebax

okey.
Hemma:tror det
ätit:yeppyepp
bytt om: too ridkläder
ska:sticka ut i stallet
måste:vara inne igen 21.00, för dåå blire Hollywood fruar! xd
tänker:på hajken......


hörs sen

//Erika

Emma i bussen

Sitter i bussen på väg hem... Våran NO på 1,5 timmar är inställd.. Så börjar 20 över 12 igen, ingen vits o va kvar i skolan så lång tid ;) får se om ja åker tbx.. Mår ju inte så bra.. Jaja de tar ja då! Sista lektionen nu va engelska, satt o lyssna o skrev i 1 h -.- hör övning av nationella proven! Gick ändå rätt bra tror jag :) o en till topp nyhet: DE REGNAR HÄR! konstigt?..Ne tror inte de va..;) /Emma

tävlingar

nästa tävling är på lördag, Carolyn princess sweetie girl ska hoppa i Fjärås 1.10 o 1.20 tror ja, inte helt säker men tror det iaf..o på söndag blire Lilla edet me Harry.. bara LA eller kanske, kanske msv B oxå.. andra gången isf..
kanske tar me Kakan o Drömmis dit me, eftersom det inte blev nått denna helgen.. så kanske blire tre hästar där LA msv B, lite stressigt men men
Elin o Jerry debuterar msv B i Lilla edet me, hoppas o tror att det kommer gå riktigt bra, dom är såå fina tillsammans! Elin rider verkligen honom sjukt bra, så roligt att se!

veckan efter LE så är det Baltic cup om ja kmr me.. är i Danmark denna gången så alllaaa skåningar ska väl dit ;) o sverige har ju bara x antal platser, så det blir nog svårt o komma me på ponny.. men kanske det blir så att ja tar o åker me CARRO om ja inte kmr me med ponnsarna.. isf blir det 1.20 kval I, 1.25 kval II, o 1.20 final
blir debut i 1.25 isf, men det är ju väldigt luddigt hur det blir med den tävlingen så, I don't know än

tror nog att vi sticker iväg till Ljungby efter Baltic, typ 2 veckor efter.. eller så va det Laholm? har inte jätte bra koll(hehe) men jag TROR att planeringen ser ut såhär.. kan vara helt ute o cykla, men mamma har koll iaf xd

ska nån av ER till någon av dessa tävlingarna?

//Erika


strömavbrott all the time

gooosh va dåligt väder det har varit här i storstaden! regnat, o inte lite heller utan STORA STORA JÄTTE droppar i massor! helt sjukt! o strömmen har gått x antal ggr.. därav den trökiga sega bloggnigen...

nu har ja käkat en yammi maddag gjort av kocken Roger, riktigt lyckad!
så ska ta o ta fram kläder inför school tomrrow o duscha, sen sova
sjukt trött....så behöver sova lite.. typ 7 timamr kanske..xd

Kakan gick  g r y m t  förut, helt super fräsh!
känns så härligt o ta ut honom varje dag, o rida nya härliga pass, alltid lika mjuk o fin.. arbetar i rätt form med underbara steg.. <3
Eve red lite på Dröm förut me, gick hur bra som helst... o jacky fick börja galoppera lite idag.. härligt att dom snart är igång, så då får ni akta er på tävlingsbanorna ;D :D

ska ta o fixxa lite najs inför imån nu så, go'natt på er!

//Erika


yammiyammi

asså jarad... lilla söta underbara goaste gulligaste korv jerry.. han är så go
när det gäller mat.. äter ALLT! o då menar ja ALLT
förutom bananer...;) o detta är en stor favorit!:

he loooooooooves smörpopcorn, its true.. Så söt! Provade att ge honom kellogs cornflakes idag me mjöl,mmmh va gott han tyckte det va! Hade no gärna ätit en hel skål, ojoj sicken ponny...xd är era hästar sånna att dom äter vad ni än ger dom?

//Erika

myser i min nya poncho

hemma från kungsbacka nu,.. blev lite shopping
en poncho från Gina
En svart "fluga" att ha till min skjorta utan ärmar(tjejmodell)
lite fler söta sockar (a)
två par Jeans från Gina
lite smink

Elin kom kl.16.00 o hoppade Jerry, gick hur grymt som helst.. 95-105 påalla hinder hoppa super, o elin red grymt!
så nu har ja käkat lite o ska göra klart matteläxan,yeeey.. sen ut o rida kakan så är ja klar för idag..
ska dra över o ge farfar sin födelsedags present, grattisgrattis farfar <3

så vi hörs sen, vet.. sjukt tråkig är ja.. but.. byebye

//Erika

Allmänt tråkig söndag..

Fortfarande ont i halsen, öronen, o förkyld.....
Hoppas de försvinner snart!

Red Cooper i manegen idag då de regnade, kan säga att han va helt otrolig i traven asså. Kan få en RIKTIGT bra form där nu... :)

Resten av HELA dagen har ja röjt i mitt rum, herregud, ja o mamma har hållit på i 2 dagar o de e inte klart än XD
Rätt mke saker har ja hehe.... (A)



Min saknade lilla plutt..
Kan även passa på och säga att Josefine o Conny tävlade Div.II igår! o de gick huur bra som helst!
Så roligt för dom e så ur gulliga ihop...
Ni hittar dom HÄR!


/emma

kba nu

två hästar klara.. Harry va lite stel, men han har ju tatt de lugnt i 3 dagar nu så han får lov o vara det, annars gick han bra idag...o Carro va liiiite stark men gick bra i slutet när ja fick henne i arbete, ska prova att rida henne på hack imån, så att hon blir lite mer lyhörd

nu har min grymmaste barnvakt åkt me, tack för hjälpen<3
så ja o mammi sticker till kungsbacka nu o handlar lite smått o gott, kommer hem innan 4, för då kmr Elin o hoppar Jerry... korven Wenderyd

så vi hörs lite mer sen,  au revoir

//Erika

stallet-nu

sticker ut i stallet nu me eve, rider två ponys with her o sen drar ja o mammi till kungsbacka...
men I promise, det kmr ett till inlägg before that!

//Erika


barnvakten är häääär

ska chilla framför TVn nu me min barnvakt,hörs imån

mina hästar säger ja bara... yammi<3

//Erika

Gash va fin cooper är

shit va fin han var idag.....finns inte ord..<3
Red dressyr i paddocken idag med gramanen, o ja kan säga att ha ridit på hackamore en vecka har hjälpt, han är lyhörd i munnen , lyssnar suuper fint! Känns underbart.
Allt bara funkar mellan oss just nu, hoppningen, dressyren, hanteringen och de klickar verkligen.
UNDERBART.


Kom ur duschen för en stund sedan, så sitter o kollar på TV just nu ska snart käka med min familj.



Tycker alla borde hålla en tyst minut för världens sötaste lilla bebis.

R.I.P Ernst 26/8 2011.

<3


Btw; ja drogar halstabletter just nu....blöööö


Emma right now:








/emma

@@@@

@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
gick upp tidigt, trött men sjukt taggad inför DM.... fixade hästarna o fick till riktigt snygga o nice toffsar/knoppar
kom till tävlingen,lasta ur o stressa lite, trodde de va brottom... red fram o allt, skrittar till framhoppningen men kommer inte in bara för att jag inte fanns me på listan??!! men det visar sej att det var framflyttat till 10 ist för 09 så dom låg en timma efter, så det var LB+5 som höll på.. suck.. bara till att ställa in igen
tog ut honom andra gången, red fram i 1,5 timma bara för att dom flyttade fram,o igen,o igen o så höll de på..!
kl.14.00 sa dom att vi ställer in.. så då hade ja slösat 6 timmar på att rida EN häst i Falkenberg, utan att hoppa ett ända språng!
tog ut o kakan o red lite där en stund bara för att ha gjort det.. ojoj

så sjukt tråkig eftersom ja va så taggad, o hästarna va sjukligt fina idag!!;(
 aja, det är bara o glömma o tagga till nästa gång

//erika

På väg hem från Falkenberg: resultat från DM 2011

Yepp... 6 timmar,gått upp tidigt,hästarna har ALDRIG kännts såhär fina på framridningen- helt grymtfantastisktubderbara,riktigt taggad..... Men---> det har ÖSREGNAT hela dagen,det har åskat,blixtrat o ja.. Vi skulle tävla på gräs... Tävlingen blev framflyttad 10 min-20 min-30 min o så fortsatte det.. Jag hade ridit fram drömmis 1,5 timma pga det o kl.14.00 så säger dom: vi ställer in! Jahopp, inte en ända start för mej idag, o 6 timmar åt skogen, jiiiipieee //erika

iväg agaaain

jäsp.. sticker iväg till tävling nu, falkenberg DM 2011 ponny me Dröm o Kaka, sjukt taggad-sjukt trött

hörs under dagen me lite resultat oså, bye

//Erika

:'''''''(

inne från stallet, putsat o packat.. ridit Kakan o Dröm, Carro red pappa idag på dan när ja va i skolan.. o Harry vilar en till dag så att han läker lite...

dagen i skolan-nice.. un peu triste men ändå nice
efter skolan- ......?+@@£$€€\+½§$£@@
eftermiddag/kväll-nice, hästarna va fina o fräsha.. o ja har snackat me dom, o dom är helt me mej om att vinna DM imån xd

va i kungsbacka efter skolan, som ja sa igår.. börja bra, hade me mej pengar.. nåra hundra o skulle gå o köpa lite nödvändigt.. jeans o ett par spetsstrumpor.. går i i första affären, kikar lite o hittar två saker ja vill prova.. går till provrummet o upptäcker- var fasen är pengarna.. letar ihjäl mej i 1,5 timme, noo money!! går igenom butiken 67543,9767 gånger utan resultat... o är tvungen att åka hem utan nått me mej, nåra hundra fattigare o 3,5 timma bortslösat till INGENTING
@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
så ja, va rätt arg,sur,ledsen o allmänt gaaaaaahig efter skolan.. har lugnat mej lite nu xd
men pappa lagade en grymme middag,hästarna gick fint o ja ska hoppa DM imån.. såren är liiiite läkta xD

så nu ska ja ta o duscha dricka te o sen sleep and taggataggatagga.. är nån av ER i falkenberg imån?

//Erika
 

*

h*lvete

TÄVLING

nu är ni nåra som är med i tävlingen, men FORTSÄTT ANMÄLA vi avslutar när det blir tillräkligt många!


sm bilder- ja tack!

Felicia Andreasson :D om SM bilder tagna av....:
Tror ag har bilder på dig, kan skicka dom isf, men ska jag skicka till din mamma då eller ? :D
IP: 90.229.240.149

oooh ja tack snälla skicka dom! :D

//Erika

sjukelisjuuuuuuuk

usha då... jag va hemma idag, super tråkit.
Men så e de ibland ;)
Jätte kul att ni engagerar er nu o kommenterar!

De gör en taggad o fortsätta skriva!

Cooper fick lös galopperas i paddocken idag! Haha han va liiiite pigg ;)




/emma

merci

Rebecka  (dailyhorses@hotmail.com) om mtach hit o match dit:
Jättefin blogg! :)
IP: 83.226.129.64
 hej Rebecka! tack så himlahimlahimla mycket! roligt o höra!

//Erika

btw ni har varit riktigt duktiga på att komentera nu, känns SÅHÄR mycket roligare o logga in, o se att det finns nya komentarer, så keep it up, så gör vi desamma!

Strumpspets

idag drar ja me mammi till Kungsbacka o köper mat..
hon kommer o hämtar mej direkt efter skolan(14.30 lr nått) o så åker vi till kba, är la hemma runt 17 tror ja
ska ta o kika in på Kappahl,gina o en ny (as snajjsig) butik i Kungsmässan.. skulle behöva this:

*helt vanliga blåjeans.. upptäckte att ja har hur många byxor som helst, men inte ett enda par "vanliga" blåa..!
*jätte söta strumpor, kort modell med en spetskant längst upp, jätte fint att ha i mina nya najsiga skor! :D

o så nått som ja VILL ha... inte behöver....xD

*bruna short.. riktigt snyggt på hösten

får ja se fall ja får tag på ett par jeans o mina gulliga strumpor xD isf, kommer bilder.. o 17 oxå, ja skulle ju fixxa bilder på skorna..okey, ja vet.. ja sa-" oooo I promise.. " igår me, men today.. så lovar ja, lite sådär halft..xd ska försöka komma ihåg, ni får påminna mej! ;)


//Erika

massa svar hit o dit..xD

Jenny om men då så :D:
änglahoppet ska jag iaf på sen blir det andra tävlingar också men inga inplanerade för tillfället ;) aah! det visste jag redan hehe xd ;) bra blogg föresten! :D
IP: 78.70.220.48
okey, tror nog att ja ska till Änglahoppet me, så då kanske vi ses? :D
tack så jätte mycket, riktigt roligt o höra!

kram
//Erika

natti

trött-yepp
ska-käka kräftor
vill-sova..
måste-duscha
skulle behöva-plugga lite
funderar-på att faktiskt ta o plugga lite
bästämt mej för- att plugga lite
vi-hörs imån!

te nu, o kräftor.. hörs imån... hästarna va grymma today.. nästan hela tiden xd

//Erika

mtach hit o match dit

Jag är väldigt  noggran när det gäller hur ja o mina hästar ser ut på tävling..
allt SKA vara putsat, hästarna ska helst ha knoppar, även om ja slarvat lite me det de senaste på Kakan eftersom vi nollade msv B utan knoppar, så då känns det lite som en ur sak...xd
men annars, alltid fina, borstade.. glansiga svansar,snygga schabrak,har speciella schabrak på tävling.. rider ALDRIG me tävlingsschabraken hemma, utan där har ja hemma schabrak., så ja har en del schabrak.. typ 25 av varje eller nått xD
tävlingshjälmen.. whitaker, hemma har ja mammas GPA, putsade sporrar, fin spö.. ja ni fattar grejjen
o det ska vara snygg o städat utanför mina boxar! lägger ALDRIG bara ihop saker i en stor hög, utan ja hänger upp schabraken noggrant på en "stege", samma me täckena.. boxgardiner ska upp, grimmor o träns hänger snyggt på tränshängare på skåpet eller boxdörrarna.. det ska vara sopat utanför, o ja.. allmänt snajsigt

o ja tänker väldigt mycket på hur det ser ut, fall ja red bra, såg det fint ut,va hästen fin,va det en bra runda,satt ja konstigt på det hindret,va han lite stutsig där.. o ja dömmer mej själv ganska hårt ibland, tar på mej lite väl mycket.. o det är en sak ja ska träna på, för ja behöver inte sitta o gå igenom varje sekund av rundan, exakt hur det såg ut där o där..

rätt noga hemma me, vill ha fina matchningar när ja rider.. inget måste att ja o hästen matchar, men om ja matchar för mej o hästen är matchad för sej- funkar bra..
haha, ja vet.. kanske lite onödigt, men det känns som ja får en bättre känsla o rider bättre när vi ser lite okey ut.. är såklart inte så, men känslan xd

men sen, när man kommer hem efter en låång tävling.. hästarna vilar en dag o sen ska man skritta.. då kan man släppa lös  mysklädsen, onepiece,mjukisar,hack o skritta ut i skogen.. det är helt okey! lite mys o pys måste de va ibland, eller va tycker ni?

hur är ni? är ni noggranna me att putsa innan tävling o matcha kläder o schabrak på träning/tävling?

//Erika

frukost i skolan

på fyra ben går den som ja gillar allra mest, gillar,gillar,gillar allra mest...
ja sitter på han rygg för han är min lilla häst, är min lilla häst.. va du är söööt min kära lilla ponny, va du är snäll min kära lilla häst...

Hemma nu från skolan, ska ta o sticka ut i stallet o rida 2 lr 3 hästar o lösgaloppera en.. det beror på hur harry ser ut på huvvet nu, fall han fortfarande har sår o så..
dagen i skolan har vart chill.. hade hemkunskap sista lektionen, fixxa en stor frukost ;) yeey va mumsigt!
godast va la lätt gröten.. recept:

*1 dl Havregryn
*2,5 dl vatten
*1 krm salt

yammi va gott det blev... eehm? Haha men roligt hade vi, o mat blev de, o de är la det viktigaste?
så nu taggar ja sista dagen imån, o sen blire helg o tävlingar igen.. ska hoppa DM på lördagt me Kakan o Drömmis, o på söndag blire Carro DM.. vinna vill ja, eller går det att bestämma i förväg? isf, ha rja paxat vinsten nu!
nån av ER som är där nån av dagarna?

nu skriker hästarna.. hör dom hela vägen in i huset... mmm
så nu drar ja, hörs sen

Erika

men då så :D

Åh va roligt, vilka tävlingar ska du på mer i år? :D så kanske vi ses nå mer gång?
såg nu oxå att din ponny är bror med min B-ponny som rids av Elin Gustafsson, E. Priory Dallas...

kram
//Erika

ska ja,,.. klick

skickar in en ansökan nu.. tror jag

//Erika

sjukt bra program asså

True talent... love it!  så mycker mer fair än idol o sån skit ;) grymmt äre!

hästarna skötte sej.. Dröm va lite mes men fin o Carro hade glömt hur man fatta galopp... låter bra, I know..
men Drömm gick jätte fint hela passet o arbetade bra! o Carro va super fin i traven, o bra i galoppen när vi väl kom igång xD så go är hon, när hon får sina små blackouter xd men fin, det va hon!

Kakan lösgalopperade pappa en stund, ja kom ner i slutet... o sen hämtade ja Harry o galopperade honom, grym ponny man har som travar cavalettin by him self o hoppar två små hinder i galoppen o sådär, bra att han lär sej träna själv! ;D
Bilder på skorna komemr imorgon, looove dom asså, så sköna, o grymt snygga.. om ni frågar mej då... men promise, tomorrow!

nu ska ja ta o fixxa lite te o så till den bästa familjen, o sen blire lite läxor o duschen :D

hörs imån då!

//Erika


Soffa e en bra uppfinning..

Haha som rubriken lyder!
Soffor e jädrigt bra när man e seg o bara orkar titta på TV ;D

EmmaSahlberg muppar sej o har tråkigt, detta är resultatet:









HAHA alla bilder e ej från idag ;)

BJUSSAR stort....



/emma

mitt hjärta.

Cooper har varit jätte fin hela veckan hittils! Är tyvärr så att ja måste rida på hackamore, för han har ett sår som börjar blöda varje gång ett bett är på. Stackarn... Så han har ju ingen toppen form och går på tygeln nu direkt hela passet, för han blir väldigt stark ;) Men de går ändå jätte bra!

Måste be om ursäkt för min kassa uppdatering men jag har ju börjat 9:an nu så de tar tid med allt nytt o ja, de e rätt jobbigt :)



Världens vackraste, tillsammans kommer vi gå långt <3


/emma

stolt- helt klart

Jennie om veckans fråga:
jag har två egna ponnysar. den ena är skaddad just nu ås då satar jag på den andra. Jag har ridit henne upp till LA:P1 i elitlaget dressyr ofc. STOLT :D. Hon heter Katitzi :) och erika vet vem jag är om hon använder hjärnan, vilket hon ofta gör.

kyssen<3

P.S var bara tvungen att skryta lite, inte för att jag är upp på eran nivå men men...D.S

Hejsan Jennie(min sötaste)

inget skryt alls! finns inget som kallas skryt, att vara stolt över någonting man har gjort.. är självklart!
att tävla LA:P1 dressyr- det ÄR svårt! jag har inte startat en ENDA dressyrtävling NÅGONSIN, hör o häpna.. men det ska det bli ändringar på..;)

va inte rädda att säga om ni är stolta, om ni känner er duktiga,fina,vackar,eran häst är grym.. asså avd som helst! för man har ALL rätt att känna så, min åsikt!

saknar dej Jennie, btw

kram
//Erika

streessa ut nu, hörs sen

okey, dag 4 avklarad.. o nya skor-check
så nu sticker ja ut i staller, rider två hästar o lösgalopperar två.. ska försöka va inne till 20.00..True Talent vettni..o klockan 1 18.04 så ja får nog ta o sätta fart lite, or what do u think?
komemr bilder på skorna o lite mer nice ikväll, promise..!
men nu måste ja sticka så, ciao!

//Erika

buuuusen nr 1

du.

hur kan du? ser du inte vad du håller på att göra, ???

//Erika


beslutsångest

okey, imån gäller det då.. eller?? ska ja.. gaaaaaaah
vet inte om ja vågar, men ja vill ju?! eller ska ja vänta med det tills nästa år?
need some help, what do U think?

sticker till skolan nu me, så vi hörs sen<3
blir nog till att åka till Kungsbacka i eftermiddag, o köpa lote skor.. behövs verkligen!

//Erika

en sån här tråkig rubrik

inne från stallet, kl.20.00.... I MADE IT!!!
haha lite stolt ändå, klarade faktiskt att vara inne 8 på en vardag efter skolan, o tre hästar blev ridna o två boxar mockade.. riktigt skönt!
Harry fick vila idag, för han har fått massa sår på hela huvvet, o kan inte ha träns på sej.. jätte konstigt, o synd om honom framför allt! så nu har han ludd överallt såfort han måste ha grimma eller träns, o så får han vila några dagar o läka lite.. <3

Kakan red ja i hoppgruppen kl.19.00, gick bra.. o han va faktiskt l u g n! skötte sej fint hela passet, blev lite stark ibland men lyssnade tillbaka.. dock va det lite svårt att trava över bommar i den slutliga övningen xd

Drömmis fick lite kondis träning i PD, fin.. o lite mesig eftersom han vilat, min gullis.. alltid lika go <3
o Carrsan red ja lite dressyr/markarbete i PD, fin tjej today! lätt

o  mamma berättade en jätte rolig sak förut! Ja o Carro va PLACERADE i 1.20 i i helgen! (vi åkte hem för att vi inte han vänta) så  dom skickar rosett o så me posten, o är framme nån dag snart! :D så glad, så sjukt go känsla! allthon o jag gör är första gången.. första gången för mej,min första storhäst.. o första gången för Carro... så vinsten i 1.10 i Bollebyg.. ja va första personen att galoppera först i ärevarvet.. nollorna i 1.20.. ja e först me att kvala 1.30.. placeringen i 1.20.. ja e först me att placera mej i 1.20 me henne.. så härligt, att vi gör allt för första gången tillsammans! <3

satt o titta på True talent förut me, ALLA va så sjukt duktiga, tycker verkligen att alla skulle gå vidare... för dom va sjukt bra! men det är ju en tävling.. så nån måste ju åka ut.. tyvärr
men gillar detta programet grymt mycket! så mycket bättre än idol, bara din röst spelar nån roll... o det är MÅNGA fler dommare.. o mycket mer fair! gillas skarpt

så nu blire te, o så hörs vi imån!

//Erika


Erika undrar... lite nyfiken får man la vara ibland?

Jenny om veckans fråga:
jag har två ponnysar! En 7 åring som jag tävlar på nationell nivå på! upp till MSV B än så länge ;) och så har jag en fyra åring som jag inte haft så länge som jag ska ut och hoppa lite clear rounder och så i höst/vinter! :)

Och inom hoppning så klar då hehe xd :D
heejsan Jenny!
nu är det så att ja är en vääldigt nyfiken person.. o därför undrar ja, va heter dina hästar? o kan det vara så att vi har setts på någon tävling någon gång? eftersom du tävlar din ena ponny upp till msv B på nationell nivå, så borde väl vi vart på samma stalle nån gång? :D

stor kram
Erika

veckans fråga


har ni som läser detta, ni som läser våran blogg.. någon/några egna hästar/ponnysar?
i så fall, vad heter dom o vad gör ni tillsammans? myser ni o har det roligt tillsammans i skogen o på ridbanan, eller tävlar ni oxå? :D

//Erika

Sätila skolan dag 3

home from day nr 3 in school.. it was really nice, yee
så nu sitter ja här o käkar hallon(a) frysta såklart.. hehe
ska ta o dra ut i stallet om 10 min, skrubba ur hästarnas baljor ute o fylle me nytt vatten.. sen rida 3 hästar innan sju o klockan 7 ska ja hoppträna Kakan.. 'hos Lena Berggren ( lenaberggrenrid.se)
aaand at 8 its True Talent, får inte missa det.. ända dagen på hela veckan som ja kan sitta framför TVn kl8, hände rinte.. ja brukar vara klar i stallet vid 10 halv 11 på vardagarna.. men today ska ja klara att vara inne 8, yepp

men lovar att det komemr inlägg sen me, så ja ska inte bara vara tråkig! ;D
men såläng,hre bra!

//Erika

finaste ekipaget, som ska debutera msv B......i.................

morning


hörs sen! sticekr till school now..
dagens är:
Tröja: vitt linne blå vit randigt
shorts: vita lite höga
Tights:svarta
skor:converse
Hår: platt lugg, inbakadfläta
Smycken: Halsband vitt me en toffs o ett hjärta , pärlarmband
parfym: nån go sak från pappi
smink: nothing! Ja o sandra har utansmink dagen today ;)

byebye

//Erika

dax att sova snart.. jäääsp

asså ibland,ibland ibland ibland fattar ja verkligen inte va ja tänker me!?
idag vare nämligen så att harry skulle vila.. o carro vila.. o ja skulle rida Kakan o Drömmis
Eve kom precis när ja åt middag o hon hade brottom så hon skyndade sej ut själv.. o då käka ja snabbt, o stack ut snabbt för att hinna rida en stund me henne.. o ja tar in första hästen..borstar,sadlar,tränsar o går ut.. sitter upp o skrittar fram o sen- komemr ja på.. faasen jag skulle ju inte rida harry idag!
sååklart att ja har fixat fel häst o tatt ut.. xD asså så himla korkad känner jag mej!
det va ju bara till att sitta av o ställa in honom igen o ta ut rätt häst-Drömmis xD
ojojojojoj.. ja börjar bli glömsk redan!

Drömmis va jätte pigg idag! red ut me hacket.. o lilla sötnosen va rädd för ALLLT.. bara frös fast i marken o stog me spetsade öron på helspän o tittade nervös- när det kom ett par gående längs vägen.. xd
fick han i n g e n s t a n s ! men tillslut, efter att dom väntat på att ja skulle gå i ca 5 min så fick ja honom att trava förbi.. o så travade ja en bit o sen vände rja o galopperar tillbaka, tror ni inte han är gaaalet pigg(vilket e roligt) o bara sticker? så ja kör om det här paret i full fräs(tur att dom stog kvar på en sidoväg) o så precis när ja är förbi så gör han ett bocksprång xD o drömmis som a l d ri g bockar! så gullig!
men vi känner varandra så bra o ja vet att han aldrig gör nått dumt, så ja bara skrattar ju när han är såhär busig...<3

Kakan red ja ett dressyrpass för mammi i PD, gick great! grymt fin i formen,lugn.. o balanserad!
duktig kaka<3
så nu ska ja dricka lite te(hihi) sen duscha..har suttit o skrattat åt Svenska Hollywood fruar i en timma nu, såå goa är dom va? älskar de programet ;)

hörs tomorrow!

//Erika

pannkakor (a)

Hemma nu, lång dag i skolan.. men har bara 2 hästar att rida idag, så ja hinner ta de rätt lugnt me ;)
skolan va rätt go idag.. eller asså folket i skolan va nice, lektionerna= blööäh
SO-franska revolutionen....
Svenska-Skriva novell .. rätt fun faktiskt
idrott-friidrott... okey..
Matt- ja, alltid samma eller? siffror hit o dit 1x98266664555 ½/765346 +736284832-2344= ?? tur att ja är rätt bra på det ändåå...
'''
så nu ska ja ta o äta lite pannkakor, mums
sen sticker jag ut istallet då o fixar lite där innan Eve kommer.. Rider en me henne, o en när hon åkt.. lotta gör nått me jerry så att han får röra på sej, o kanske hon mockar nån box me? det återstår att se ;)

så vi hörs sen, me nått video inlägg kanske? or something else..

see ya!

//Erika

imån äre en grej dåva.. som ja gäärna vill till.. men vet inte om ja vågar? eller kan? JA/NEJ


Bilder från GFRK!

Så sjukr fina, kommer från denna hemsidan!

--> omhoppning!





LA:






Åh kan inte se mig mätt på honom.

Du är allt ja behöver. <3


KOMMENTERA !


/emma

I'm Back.

Varit rätt skönt med en liten blogg paus...

Men nu kör ja poå så mkt ja orkar, med tanke på akolan då ;)

Kan väl börja med att säga att ja tävla i fredags som ni redan vet, men här kommer resultatet:

LB A:0/A:0
Super, bästa rundan någonsin! Så glad, allt satt o han lyssnade suuper!
2:a Plats! :D

Denna höjden känna lekande lätt nu asså.. Härlig känsla!

LA A:0
Han va jätte fin även här, men tyvärr så är ja så klantig...
Till första hindret va de som att rida igenom en SJÖ! Så mkt hade de regnat..-.-
Men hursom hoppa han stort o ja hängde inte riktigt med så han peta med bak.
Sen till 4:an så vet ja inte vad ja gjorde..? Jag bara höll in o släppte aldrig, så då stoppa det. MITT fel totalt.
Klappade honom och red på igen, o då hör jag Erika skrika "BEN EMMA!" Haha xD han hoppa de super fint! Resten av banan va klockren, inte i ett enda hinder!
Så ja kan ju säga att om ja inte klantar mej nästa gång sitter nollan, LÄTT.



Hursom så är ja mer än nöjd med dagen.
Ponnyn, herregud. Kommer ALDRIG kunna hitta en mer perfekt ponny asså.
Som VILL så sjukt mycket.




Bild från LB.

Hemsidan är HÄÄÄÄR!



/emma


Asså vill men vågar ja verkligen..?

Vet inte om ja vågar? Ska ja försöka.... Eller inte? Suck //erika

morning


Nu sticker ja till skolan, ciao!

//Erika

natti alla

alla hästar klara.. o ja ska hoppa in i duschen,sen sooova, zzZZzZZz

red Harry lite i paddocken, i skritt o trav o arbetade honom för att få han mjuk o följsam.. lite stel lill killen serru xd o så har han kliat sej på huvvet så att han fått sår, så ja hade ludd på hela tränset idag! såå söt<3
Dröm skrittade ja bara ut o myste i skogen.. o travde o galopperade lite på grusvägen.. pigg/busig/o mega mesig xD men ja bara skrattar ju, han är så söt när han blir rädd för alla små saker hela tiden, gull <3

o så provade ja att tömköra kakan idag.. har precis lärt mej hur man gör.. eller ja kunde innan men, ja jag har la blitt lite ringrostig xd men aa, idag provade jag o det gick grymt bra! tror nog att kakan gjort det förut, han gick på tygeln, i en samlad bra trav o galopp.. o jobbade på me hela kroppen, så fin!

påväg upp från ridhuset så får ja världens klockrenaste fråga från pappa...:

som ni vet så har ju mamma gips, så ha de i tanken..

Erika- (går förbi pappa som står vid hagen) jag tror nog att han gjort detta förut!
pappa- vadå(vänder sej om)
Erika- ja men vi tömkörde ju
Pappa- Asså? gick det bra?
Erika- Ja super bra, han va jätte duktig!

oo nu till frågan:
pappa- Va det du eller mamma som tömkörde??

o ja, eeeehm?
hahahaha så genomtänkt fråga xD


me d avslutar ja, natti*!

//Erika

Carro storis/ponny?

Lisa  (sokrates.star@hotmail.com) om tävlingen idag:
Är carro storhäst?[:
IP: 83.183.103.124
Hej Lisa! Ja carro är en storhäst på 167 centimeter :D

//Erika

tidspress

EN MINUT...en minut.., det är allt vi har på oss för att göra ALLT perfekt.. för att lyckas..
en minut på hoppbanan, o allt ska stämma.. minsta lilla miss, kan kosta en seger.. eller ett nedslag.. stopp
o två stopp.. två missar, är allt man får göra innan man måste gå ut? TVÅ små missar kan kosta 150 kr o en uteslutning?

funderat en del på det.. tänk hur lite som behövs för att en runda ska bli "förstörd"!?
hur mycket konsentration o träning,sena kväller.. massa ridpass på olika hästar,heta sommardagar,iskalla vinterkvällar,jobbiga eftermiddagar hårda dressyr o hoppass som ligger bakom den där minuten?

alla vi, ryttare, kämpar.. olika mycket såklart.. beroende på mål,häst o hur mycket man VILL utvecklas o hur långt man VILL nå.. men alla kämpar
vi lägger ner massor av tid i stallet,på ridbanan med hästen.. olika mycket såklart här med, men massa tid blir det! o sen ska allt vi kämpat för,slitit för,jobbat alla timmar, avgöras på EN minut, o då MÅSTE allt stämma.. fast, ibland kan man ha turen att hästen hjälper till.. men annars allt

o två stopp på en tävling, två små missar.. kan göra att vi gråter floder o är deppiga i flera dagar.. men egentligen, två små mini fel, är det så farligt?
om man får två stopp på en träning så tänker man, fasen vi tar om det.. men på tävling så vet man att nu gälelr det, nu måste det stämma!

ibland måste man tänka med lite perspektiv.. för tänk så många gånger jag har gråtit,vart ledsen,förtvivlad över två små stopp.. suck*

så tänk på det, nästa gång du blir utesluten,missar,får ett ner eller två ner.. en minut är lite tid.. man kan inte alltid få till det.. det är bara att ta igen sej.. eller som mamma brukar säga:
-Bryt ihop o kom igen! ;D

//Erika


tävlingen idag

Resultat från tävlingen me Carro:

1.10- LB 0/4 fel

Hon va jätte fin, hoppade riktigt högt över hindren... lite stark o pigg men härlig! Blev ett missförstånd i omhoppningen då jag vände upp väldigt snäft på ett räcke o ser att vi ligger fel, så jag håller i henne för att ta två korta galoppsprång, o då hamnar vi mitt imellan.. o river. Mn annars toppen!

1.20-LA 0/0 fel

Grymt fin! allt stämde, kom rätt på alla hinder o hon hoppade toppen! riktigt nöjd med denna rundan, vet inte fall vi blev placerade.. för det va en lång klass o ja startade som nr 5 så vi åkte hem.. men, det blir spännande att se ;) o NU är vi kvalade till 1.30- MSV B! :D

Film från LA kommer, proomise.. ska bara fatta hur man laddar över den från kameran xD

a question

har en fråga, som jag ställt förut... men ser att det har kommit massa nya goa läsare(ni är grymma,remember that) så här kommer den again....

Hur uppfattar just DU mej?? Är jag en person som DU skulle vilja lära känna? Hur ser ni på mej lixom, glad,flummis,arg,sur,tråkig,rolig,snäll,go,bitchig? ;D

snälla,please massa komentarer på detta nu då, skulle vara riktigt roligt o veta..!

//Eran Erika...?

1.10 1.20 me Carro today

Sitter i bilen nu påväg till tävling me Carro... Allt puts o pack är me o vi är taggade till tusen! Dagen igår va super grym!! Sjukt Goa människor, o inte bara vi ska ni veta! 50 min kö på alla grejjer, så ja va hann vi åka? 4 saker kanske?:o gick hela kvällen me Olivia,Desirée,Joy,Cornelia,Louise,Ella ,,.... Kommer massa om kvällen sen.. Massa o berätta.. Eller? Hörs sen me resultat me!//erika

Drömmis...

HAHAHAHA hittade en grym bildserie på Drömmis på denna sidan me, asså drömmis... suck
Kommer fyra, drar jääärnet o sticker förbi 3,2,1 o leeder ärevarvet! ända tills han kommer på att han ska göra sin super vändning.. x'D




alla hovar i luften.. flyyying drömmis xd



mina guldklimp <3 loovar att det kommer en film på detta me, snart! ;D
 hörs sen när ja kommer hem, eller nä.. nått mer kommer det nog... ;D

//Erika


mer SM bilder

hittade mej till denna sidan, me massa SM bilder!
så här får ni några!


funderar på att beställa denna bilden, så fin! min dröm <3

eller denna! :D

eeeeller denna xD

eller kanske denna?

haha, i know i know.. ja har ingen plats för massa bilder.. men dom här är ju så grymt fina.. mina underbarasye dröm kille <3

//Erika

nu drar ja

Lisselisselisselisselisselisseliisebeeeerg nu me grymmaste Cornelia,Antonia,Louise o Joy :D
så sjukt roligt! är nån av er där?

gaammal bild, men såklart mina grönasköna rabbitöron är på! helt klart!
fast denna gången, ännu mer pimpade... med en silvrig krona.. snyggast i stan? oo ja xD
men, man kan inte gå på lisse utan öron, nepp de går inte!

//Erika


allt klart innan avfärd!

inne från stallet, så nu ska ja äta lite o sen byta om.. tar bussen kl.15.48 till Go:teborg..
riktigt taggad!

Hästarna gick bra idag.. Carro va lite stark o så men det gick rätt bra ändå.. red lite lätt markarbete idag bara eftersom hon ska tävla imorgon.
Kakan va lite stark han me, men jobbade på i en bra form o härlig galopp oså..
o så har ja putsat o packat inför imorgon me Carsan..outfiten blir:

Me:
*Hjälm:Whitaker marinblå
*väst: Racesafe väst marinblå
*kavaj: Animo marinblå me lila detaljer
*Stövlar: Tretorn GTX
*Handskar: Roekl marinblå
*spö: Jacson svart med ljusblå strass

Carro:
*Sadel: Prestige svart
*Träns: Svart Jacson
*Pannband: Swarovski me stora stenar silvrigt
*Benskydd: PRO-Norton svarta
*Schabrak 1: Equiline marinblått me blå/vit kant
*Schabrak 2: Rosa HV polo me marinblå kant

Tror nog att lilla tjejen(lilla....host*) kommer att vara super söt i det roisa schabraket!

hörs later on!

//Erika

hallojsan

fick nyss reda på att... ja o min klass+8B ska på hajk...  om två veckor..
ska bli riktigt najs faktiskt! förutom att det nog kommer att vara rätt så kallt.. men 10 filtar extra så är problemet löst ;) o så ja, min morron frilla..men det är väl inget jätte problem xd

men det är ju ett tag kvar, så vi tar det sen..
nu ska jag ta o dra ut i stallet o rida Carro o kakan, blev bara två idag.. Harry vilar efter igår, när han fick simträna xd o Drömmis har en välförtjänt vila i nåra dagar, nu när han har gått så stor,svårt o bra!
så det är inte jätte mycket jobb idag-... lite puts o pack för Carro, sen lite mockning.. o after that så ska ja fixa lite inne, byta om o äta o sånt, sen sticker jag in till Lisse :D

P.S om nååån av er har nån bild på mej från förra året,iår SM eller vad som helst, så får ni jätte gärna skriva till mej, hade blitt super glad för lite nya bilder! :D

//Erika

mumsi yammi

inne från stallet nu, alla ridna o klara... o ja har fått en middag i magen o allt är på topp! förutom att ja fortfarande är sjuk då, men ja ska sluta tjata om de nu.. xd
så nu sitter ja o planerar morgondagen.. blir nog ungefär like this:

09.00 upp o hoppa, vakna till liv o slappa lite (a)
10.00 uuut i stallet o rid
10-11.00 rid en häst
11-12.00 rid en annan häst
12.00-13.00 rid en tredje häst
13.00-14.00 mocka o fixxa lite
14-16.30 slappa o fixxa iordning mej
16.30 åker in to Go:teborg o Lisse me alla underbara <3
sen är ja där hela eftermiddan/kvällen, såå nice!
men hur som så måste ja fixa massa massa massa inlägg.. eller ja inte så många men some iaf.. så ni har nått att läsa medans ja skriker,skrattar o dör av höjdskräck...
ooooouuuuuh.. hoppas dom inte tvingar mej att åka atmosfear.. becuse, det kommer få me att svimma... seriöst!

en helt annan sak nu då.. hästarna gick great idag! kakan galopp/konditionstränade idag.. han har grym kondis men aja, vi behövde lite omväxling kände jag...
Carro va fin, lite stark o hade glömt av hur man fattade galopp.. men minnet kom tillbaka under passet ;)

så nu drar ja mej till sängs.. ne skojja bara.... först ska jag duscha ;)
ses imorgon.. eller? va de nån av er som va i göteborg idag på GFRK eller som ska till Lisse imån?

xoxo Erika

supersnyggadundersyrran

fall is coming


åååh, vart inne på nelly.com o bubbleroom.se nu o kikat lite, o det finns så sjukt mkt snygga saker asså!
massa nya höstgrejjer o annat nice, grr

tänkte hoppa i ridkläderna nu o dra ut i stallet då, rida två gullisar o packa in från den smutsigaregniga tävlingsdagen me grymmehästarna...<3
hare såläng, tills ja kommer in vid typ.. 8-9?

//Erika

bytt om till torra kläder...

.....o nu sitter ja här o äter lite, ovanligt.. yepp
har suttit o fixxat o trixat me en header till dessa tjejerna , im not a pro on sånt men tycker den blev riktigt nice faktiskt! längatr tills nästa vecka, för då får ja hem mitt photoshop, o då ni.. då blir det headerar åt alla håll ska ni veta xD

ska ta o se på top model nu, sen får ja la ta o byta om till ridkläder iegn o dra mej ut o rida kakan o carro, me eve o jacky... o mocka lite säkert!
o fixa lite saker för imån me, ska me Lollo,Joy,Conny,Antonia till Lisse, sååå sjukt roligt kommer det bli!:D :D
kommer därför inte bli bäst uppdatering på eftermiddan men ja fixxar lite serni! ;) komemr nog en del inlägg, fast kanske inte live...xd

skriver more later on, kram

erika

Regnig dag på GFRK

Ush,fy,bläääöööh!! Spöregn hela dagen.. Allt är blött,smutsigt, lerigt o ja, allmänt äckligt ... Men nu är vi påväg hem iaf, hästarna har skött sej bra!! Jerry o Elin nolla LB o kom 2:a o i LA hade dom ett ner men vann ändå eftersom alla andra va uteslutna :o så dom vann ett KINGSLAND täcke o tre foton! Så grymt fina o duktiga! o Harry nolla LB i grunden o fick 4 fel i omhoppningen, only för att ja glömde titta på hindret.. Ooops., men aja fin ponny iaf! O i LA( som va en svåår bana) va de inte många som kom runt! Vi rev ettan(suck) för att d va en vattenpöl stor som en sjö precis INNAN så han lixom simma fram till hindret typ o rev väldigt nätt, sen så petade han 8a för att han kom liite nära o va lite lång, o underlaget va väldigt tungt! Så det blev 8 fel... O vi kom 1:a utanför i LB o 2:a utanför i LA.. Liite oflyt;)//erika

tävlingsmorron

uuuuääääääähhh.....!!
uppe- de kan  ni skriva upp!
taggad-ja , lite halvt än så länge.. kommer nog om en stund när ja lixom börjat leva igen xd
ska-äta nu
har på mej- nya Animo byxorna,nya kingsland skjortan,blå strumpor
tänker på-mat... haha

sååååå dååå drar ja snart!! hör under dagen me results!

wish us luck!

//Erika



inför imorgon...

gooosh va tråkig jag är! bara massa trista korta inlägg.. sorry!
men känner att ja har vääldigt många saker som goes on här hemme, massa o fixa o göra..

imorgon åker jag till GFRK o tävlar, Harry.. göra nått inlägg på morronen o sen blir d mobilbloggning tills ja kommer hem, antagligen inte jätte sent me tanke på att dom har typ 3 starter på hela dagen.. , när inte riktigt men inte är d många iaf!

O allt är packat o putsat, o outfitsen för ponnypluttarna imorgon blir:
Harry: klass 1 LB Rosa HV polo schabrak me marinblå kantband,guldigt swarovski pannband,bruna veredus skydd o marin blå mössa..
klass 2 LA brunt anna Scarpati schabrak me beige kantband,brun mössa,guldigt pannband o bruna vredus skydd

Jarad: klas 1 LB mountain horse schabrak vitt me ljublå kant,svarta Norton skydd,silvrigt swarovski pannband
klass 2 LA marinblått Anna Scarpati schabrak me ljusblå "rutor" o kantband, svarta Norton skydd o Silvrigt swarovski pannband,.. o han ska vara ljusblå imån bara för att Elin ska ha ljublå tretorn stövlar ,sweet :D

så nu ska ja ta o dricka lite te, o sen duscha.. klockan är redan 23.14 and I really need to sleep..
tidigt upp imorgon för att knoppa o så.. o lite packning kvar..

natti på er <3

//Erika

önska oss lycka till..?

tävling imån då... GFRK, göteborgs fältrittklubb
LB LA Harnells Tricky dicky o så ska ja hjälpa Emma Sahlberg, som ska hoppa LB eller LB LA, not sure on that thing.. o så ska ja hjälpa Elin me Jarad, LB LA :D
inte jätte många starter imån, så det blir nog en kort dag, härligt!
På lördag ska jag åka me mina grymmaste brudar Cornelia,Louise, o Antonia(tror jag) till Lisse, så grymt roligt!
o on sunday så tävlar ja me Carro nånstans( xd) i 1.10 o 1.15 DM, tror jag att det är iaf! :D

men nu blire mat o sen rida två hästar till.. så de är bäst att ja sticker nu, seee ya

//Erika

merci!

PONNYSKRUTTARNA - sandra  (ponnyskruttarna@live.se) om schools out for today:
hej fin blogg! :D
IP: 78.69.148.226
hejsan hejsan! tack så himla mycket! :D väldigt roligt att få lite respons ibland! :D

//erika o Emma

schools out for today

hemma från skolan.. föörsta dagen avklarad.. ÅÅÅÅÅH vad jag har saknat alla! känndes sååhär härligt att träffa dom igen...(dom flesta iaf..eehmm...;) )
nu ska ja bara ta o byta om lite snabbt o lätt, käka lite o sen drar jag ut...trumvirvel... till STALLET!
oväntat va? xd
har massor att göra idag! ska rida 3 pållar,mocka,städa,putsa o packa.. för imorgon bär det av till Göteborg.. ska hoppa LB LA o hjälpa Elin o Emma :D
så, yepp.. jag börjar me att ta ledigt..! men aja, extra helg är aldrig fel, eller?

komemr skriva mer sen, så hold on.. men nu måste ja börja jobba.. för ni vet ju hur långsam ja är(!)

//Erika

SM bilder tagna av....

Ida Ericsson, super fina!

älskar denna bilden!:


liten dröm åsna? xD <3


underbar<3

the worlds greatest pony, belive me<3

wonderful pic,wonderful pony

häftig bild, i like

min kärlek till dej är oändlig....<3

super fina bilder! super fin ponny! <3 alla bilderna är från kval I msv B stilbedömning.. 63.4 päng 4:de plats! :''D

//erika- in school


vaknat-check

skola nu då.. no more rast o ro, nu ska ja knyta min sko..?
yeeey, Erikas morgonhumor e tbax! tro mej, jag sitter helt seriöst o skrattar åt,,... mitt fyndiga rimm xD
 men här kommer en dagens:

Byxor: skinn
Tröja: vit blus/skjorta utan ärmar
skor:converse
smycken:armband + kors örhänge
smink: Mascara o lite ögonskugga
humör:trött,faktiskt glad o taggad

så vi hörs lite under dagen, see ya!

//Erika

duschen skriker, go'natt!

så, inne o klar.. hästarna gick toppen, eller ja.. Harry va lite sådär halvstel men gick jätte bra i galoppen, konditionstränade han idag serru.. o Carro va lite stark men annar fin o mjuk o ja, allmänt fin helt enkelt! nu taggar vi skolan imån...eller nått sånt..
nu väntar duschen! psykligt trött! så med detta awsome(hosthost*) inlägg säger ja go'natt!

//erika

denna modellen är schabraket ja köpte idag! fast ljusrosa me marinblå kant, så sweet o riktigt snyggt!

oo sånna här röda strumpor :D

bilderna är från google, eftersom.. u know, ja o min data vill inte riktigt längre..

//Erika

...

Mår inte toppen just nu, och jag ber er respektera detta.
Uppdaterar när jag är på topp igen.

/emma


nattligt jobb

 
only old pics, för min dator har dumpat mej,gjort slut,finito,över
ja ni fattar.. den vill inte samarbeta med mej o vääägrar att snacka om det! har ingen aning om vad jag har gjort, kan vara för att ja umgåtts så mycket me Bonnie(min Iphone) men ja menar, man måste väl kunna vara me andra oxå? :O
aja, let's move on, ni får klara er tills det är löst, vårt lilla "bloggbråk", så.. nu fick det ordet en ny betydelse!

ska käka lite nu, sen sticker jag ut o rider, TVÅ hästar till... oooo ja., det är lite jobbigt faktiskt med tanke på att ja e sjuk oxå.. o skolan väntar imorgon, heelp me!

som ni kanske fattar, skolan startar imån= inte lika bra update.. men vad ska ja göra? sluta skolan o börja blogga på heltid? inte mej emot egentligen men mammi o pappi blir nog inte så glada tror ja.. fast man kan ju alltid fråga?

komemr nått tidsinställt.. me gamla bilder(sorry) o så men annars bara mobbe bloggningen tills ja kommer hem =/

hörs ikväll/inatt när ja e klar i stallet..

//erika

ut i det svenska vädret snart...

datorn lever sitt eget liv; inget funkar !!!!!!!!!@@@@@@@@@@@@@@@@@@
SUTTIT HÄR O SKRIVIT AS LÅNGT INLÄGG O SÅ BARA FÖRSVINNER DET!! ;@

aja, hej igen! hemma från kba nu, med some food o nya ridstrumpor + gulligt schabrak till mian pållar<3
bilder komemr sen, lovar! på allt förutom maten xd

nu ska jag käka lite, o sen dra ut o rida 4 hästar.. så jag har en del o göra.. yupp
förskylningen blir bara värre, har ont i halsen,huvvet,öronen,näsan,kroppen o mår illa.. fasen oxå! sååååååhääär bra timeing ;@

filmerna från sm kommer ikväll eller imorgon, när jag kommer hem från skolan... ojoj, sista dagen i frihet today... ta vara på den! så hörs vi sen, promise!

xoxo Erika

i will allways remember you <3

kom in på den HÄR bloggen, o läste på headern:

"att glömma någon man älskar är som att komma ihåg någon man ALDRIG träffat"

såå sant!

//erika

KBA nu

sticker till kungsbacka nu o handlar me mammi, kommer hem vid 16.30.. o då väntar ALLT arbete,,...
för smart (o seg) som jag är så har jag inte börjat än, yeeeey

hörs i eftermiddag!
//Erika

come home in the morning light.....

vaknade för en liten stundsen.. av att jag var helt torr i munnen,ont i huvvet o halsen... wiiiiiiee
underbar dag framför mej... ja menar hur taggad blir man inte av att vakna upp o titta ut genom fönstret o märka att det är grått,trist o almänt tråkigt...
men nu får ja ta o rycka upp mej, kan ju inte sitta här o deppa, har massa att göra idag(tro det eller ej)
rida 4 hästar,städa stallet,städa inne,åka t kungsbacka o handla,mocka, o lite små fix... så dagen är full!
o hur underbart är inte det när man är sjuk? oops, där kom det igen.. täänk positivt! efter denna slitiga dag, börjar ju skolan!? okej, skriv upp att jag sa de där,..

den här snygga bruden kommer hit sen oxå, o rider herr jackpot.. så ja får lite sällskap oxå, hahah ;)

känner att jag började skriva detta inlägget kl.10.00 o nu är den 10.35... illa asså, så sjukligt(haha) långsamt jag jobbar, ojoj!
så vi hörs sen, när ja käkat o vaknat till liv o så... xd

//Erika

te o alvedon, yammi

mitt ***** internet har hållt på hela dagen, gaaaaaaaaah@
men nu, är det fixat för typ 9876,52 gången så jag hinner nog göra klart detta inlägget innan det slutar funka igen... suck

dagen har varit ganska lugn.. håller på att bli sjuk dessutom, som jag skrev förut..bra taajming, eller kanske inte?
hur som helst, red jag Carro min E-ponny förut, fin i traven, lite jobbig i galoppen.. då hon gärna vill bli lång o inte samla sej, men ja fortsatte kämpa o hon gick super i slutet, min grymme häst!
o så red jag henne me sporrar för första gången någonsin, woooow respekt.. hahah ne men det funkade faktiskt(oväntat nog) riktigt bra!

nu sitter ja här, o klurar på vad jag ska ha på mej när skolan startar på torsdag.. ja jag vet, man behöver inte planera d nu, men va fasen.. jag tycker det är roligt så då är det väl okey?

lutar mot det här:

fast klackarna byts ut mot boots... hiss/diss?
btw, här ser ni mitt senaste inköp i klädväg.. ett par skinnbyxar á la Bubbleroom.se xd

hörs imån, nu blire te o alvedon!

//erika

Internet gaaah

No internet...@&€*^%%£¥£ så vi hörs sen! Nye, ni kan nu nå oss på siiimplythebest@hotmail.com //erika

stallet fixx

Nu är Harry klar, lite stel,pigg,glad o ja.. fin!
har mockat lite oxå, har två boxar kvar o lite stallstädning... oså ska jag rida Carro ikväll..
Eve red jacky lite förut, gick bra.. o dom har ju börjat trava me nu, finisar...
nu ska jag sticka ner till affären o handla some food.. har inte mycket här hemma asså, o ja är hungrig..
som vanligt, (a)
Elin red jerry föresten oxå! Hoppade lite inför GFRK på fredag då dom ska hoppa LB LA.. o det gick super,.. hoppträningen asså. Dom hoppade en linje med räcke 85 o oxer 1 m, o en annan oxer på 1 m, vattenmatta på 95 o en liten "omhoppning" på 80-90 :D så fina är dom! hur bra som helst! tror nog att det lutar mot en debut i msv B snart asså, himla kul!

skriver mer sen, när ja jobbat lite till... wiihoo

btw, glöm det jag skrev i morse, jag HÅLLER PÅ att bli sjuk.... snyft*

//Erika

Cristalls Jarad<3

onepiece, yeeah

hände precis en pinsam sak,.. värre än pinsam!

som jag visste så skulle Anders, våran hovis komma idag o sko kakan,bruno o carro... han skulle komma kl.13.00, vilket jag oxå visste... o när han ringer på dörren, o jag är ensam inne o måste öppna dörren..hur ser jag ut tror ni?
såååklart jag inte har borstat håret än,såklart att jag duschade igår så att mitt hår går åt alla håll, såklart att jag har min onepiece by evelina zetterström på mej, sååklart att jag låter som en kråka pågrund av mitt halsont..
piinsamt värre!
o inte nog med det!
precis när jag snackat me han o stängt dörren så tänker jag, nu går jag o byter om o fixar mej, såhär kan jag inte se ut! o sen, typ 45 min efter så ska jag gå ut i stallet o fodra o sånt.. tror ni att jag har bytt om o borstat håret? neeeeeeeäääh såklart inte! utan jag gör samma grejj igen, går ut som en stor jättebebis! ojoj

från o med nu, så hör den här klädsen bara hemma innomhus!

//Erika

Skånhällas Jackpot

okey, det här handlar om en ponny, inte vilken ponny som helst, utan min förra ponny... som nu är Eves
o för att ni ska få, hela resan... så tar vi det från början...


i ett rött stall ca 600 m här ifrån, stog en svettfux valack på 7 år... 1.42 cm hög, eller det var vad man trodde iaf
denna ponnyn, vid namn Skånhällas jackpot, reds bara hemma,hoppade hemma,red ut..hemma.. o åkte på två clearrounder...
i slutet av 2008 blev han till salu, som en liten D-ponny med mycket kapacitet, e. Rodlease Dancing Gold
o samtidigt, så stog det en D-ponny, vid namn Skånhällas Jim e,Rodlease Dancing Gold i ett stall i Sätila
denhär D-ponnyn ägdes av familjen Adolfsson o familjen Wenderyd, ja precis.. vi
o nu så kommer det serru, hur vi hittade den lilla D-ponnyn på 1.42 cm i ett litet stall... nära oss

__________________________________________________________________________________

Ida, som red Jim(som ägdes av oss o fam.Adolfsson) skulle få en till D-ponny.. som hon kunde ha samtidigt som Jim... så letandet började..
mamma hittade en annons på Hästnet, D-ponny med kapacitet, född 2001 e.Rodlease dancing gold..
Mamma ringde direkt, för hon hade ju sett jackpot innan, då han hoppat hemma hos oss en gång, så hon visste,vilket hopp han hade
Bara några dagar senare kom Ida o Jackpot hem till oss för provridning, i vårat ridhus..förra ägaren(Cecilia) visade honom först, skritt trav galopp o nåra skutt.. när det va Idas tur, så red hon bara lite skritt trav o sen sa hon
- nej, det här går inte... han känns jätte liten o är som en travare(inget illa menat mot dom, så ta inte illa upp)
så hon satt av, o gjorde inte mer...

när hon sedan suttit av så tog vi av sadeln o tittade på honom, o visst var han liten? var det verkligen säkert att han va D-ponny?

Men mamma tyckte ju att han va en otroligt fin ponny med kapacitet för stora uppgifter, så vi frågade fall dom kunde tänka sej att åka in o mäta honom, o om han var C-ponny.. så ville vi köpa honom.
japp, ingen provridning.. nothing, men om han va liten, då skulle vi ha honom!

besiktigades o slutmätte till 1.39,5, C-ponny... o min dessutom
..........................................................................................................................

när han kom, var det inte tänkt att jag skulle rida honom.. utam mamma tänkte fråga Ida eller någon annan fall hon kunde rida honom, i nått år eller så.. sätta igång honom o börja tävla o utbilda...
men när han bott hos oss i ca 1 vecka, så frågade jag.. snäääälllaaaaaaa mamma kan inte jag få prova att rida honom?'
o det slutad emed att, vi bestämde oss för att ha kvar honom hemma o låta mej utbilda honom själv!

han kunde ju alla grunder o så, han kunde ju hoppa o ja, han var ju inte helt otränad.. men när jag började rida honom så kunde han bara gå i lååååååång galopp på fyrkantsspåret, i 1 eller möjligtvis 2 var, sen saktade han av till slängtrav.. det gick absolut inte att korta galoppen, o knappt att rida volter o galopp, för då bröt han av
det gick inte alltid at styra honom dit man ville, o han va seg, ja om ni har sett honom.. det ÄR sant, han va SEG

men vi tränade,tränade,jobbade,dressyr,tränade o jobbade upp konditionen, han kunde korta sej,han va styrbar(för det mesta xd) o han var mycket mer musklad!

så jag skulle prova att tävla honom.. o jag minns inte var,när eller hur men det var LC LB tror jag...
felfritt, båda klasserna.. o ca 60 cm över varje hinder!
o efter den gången, så fortsatte det, jag tränade honom flitigt för att få honom starkare o lydigare, o vi tävlade.. LC,LB,LC,LB,LC,LB o felfritt hela tiden, han va helt grym!


efter ett ganska långt tag med LC LB så testade vi en clearround på Kungsbacka ridklubb, 1m. LA
det gick okej,han va het.. eftersom all träning hade ändrat hans temprament TOTALT
vi hade två stopp på ett räcke med nåra läskiga röd/vit/blå/gröna saker under.. men resten nolla han
o två veckor efter det, debuterade vi LA på tävling. I trollhättan..
vi kom först 6:a i LB, hade precis lärt oss rida lite fort!
i LA så va jag meeega nervös, ja mena de va ju första gången! men vet ni?
vi dubbelnollade o kom på en 2:a plats.. helt amazing! underbar känsla!

efter den tävlingen, så gjorde vi nolla på nolla på nolla i LA, tävling efter tävling..tror att vi nollade 10 st på raken elelr nått.. o om vi inte nolla så hade vi 4 fel

efter att jag ägt honom i 1,5 år så tänkte vi att det var dax, att testa en msv B...
vi debuterade.. o det, gick åt skogen.. men , det kan ju inte alltid gå bra?

men vi testade en gång till.. gick inte så bra då heller.. o då gick vi ner.. hoppade LA igen, felfritt
jag ville ju hoppa msv B, jag trodde på oss o att vi kunde klarar det!
så vi provade igen, en natiobell Msv B i Skogslotten, liten bana-- regnat oavbrutet i 2 dagar, såp det var väl typ 5 m djupt? haha ne men det va tungt att rida på, det va de!
men, allt släppte för oss, vi red denna stora Msv B med ett nedslag, jag va överlyclig! vi hade klarat det, jag hade bevisat för mej själv att vi klarade det jag trodde på!

dagarna, veckorna fortsatte.. o vi myste,tränade,hopptränade o gjorde allt, på ett sätt som vilken vältränad häst som helst tränar på, vilket var ett strt framsteg d me!
o vi hade bestämt in en till tävling, Frillesås, LA Msv B


dagen kom för tävling, vi va taggade, såklart!
nollade LA, A:0.. red inte fort eftersom jag bara ville göra en fin runda inför msv Bn,...'
det va inte många starter, B C o D ponny va ihopslagna, till en ända klass! så det var två globengehäng, ett till bästa C-ponny o ett till bästa D-ponny!
fast det va ju inget jag tänkte på, för min inställning va inte att vinna
det va en ganska lång bana, 9 eller 10 hinde rom jag minns rätt,trekombination.. soim vi bara hoppat en gång innan på tävling, trippelbarr o knepiga linjer..
o det grymtcoolahäftigaawsomegrejjen som hände va att vi nollade!! o vet ni mer?'
vi kom på ANDRA PLATS efter en snabb,rutinerad B-ponny.. B-PONNY! Vilket betydde att vi var BÄSTA C-PONNY EKIPAGE O FICK ETT GLOBEGEHÄNG!
så ja, vi VANN faktiskt en msv B!
helt sjukt! så glad jag va o är! att vi gjort allt detta tillsammans, från att hoppa två clearrounde ro gå i slängtrav o lång galopp, till att vinna msv B!! underbart

o nu, har jag ägt honom i 2,5 år trygt, o har lixom låtit Eve ta över honom, så nu är han hennes ponny...
tyvärr så började deras "resa" o tillsammans med en kotledsinflammation o lite tandgrjjer, men som nu är löst! så han är under igångsättning, o får börja trava denna veckan..!
o jag hopaps o tror, att evelina o jacky kommer han minst lika roligt som vi två har haft! o dom kan absolut komma långt tillsammans!
min Jackpot, en riktig Jackpot!

//Erika





internet @@@

Skrev värsta långa inlägget precis.. o när ja skulle trycka på spara o publicera så pajja internet o allt försvann.... *@\$£@#¤£*@

aja, nu är jag back on track igen...
så här får ni inlägget igen:

Uppe-yepp
trött-om jag är
ska-rida fyra hästar
vill-chilla på soffan
tänker-chilla på soffan

nepp, det här funkar inte... inte samma känsla andra gången man skriver det lixom.. så nopp de får va
______________________________________________________________________________________

Go'morron på er nu i alla fall! vaknade för en stund sen, o har käkat frukost bestående av 3 mackor, muuma
är sjukt trött, även om jag sover läääänge... känner att jag måste ställa om mej nu o lägga mej tidigare.. eller inte jätte tidigt men iaf innan 00.00... så att jag orkar upp 06.15 på torsdag.. skola vettni
o ja, jag är faktiskt taggad... är jag sjuk? nopp inte det minsta! liite ont i halsen men det påverkar nog inte det xd

tänkte att jag skulle skriva ett långt inlägg nu, om dendärponnynsomjagsnackadeomhäromdagen, om våran resa
så håll utkik nu, eller sen? eller ah.. titta in igen...

så hörs vi snart!

//erika

film, eller??

Vill ni ha film från SM? Kakan,Harry o Dröm?
isf, komentera....
 



//erika

syrran all eftermiddag

bad update, yeah I Know...., but I have been with my best friend, my sister.. Evelina <3
yepp, grym eftermiddag/kväll me syrran, tog lite kort o sånt kul.. wiihoo

red Carro(som hade glömt hur man fattade galopp) o Harry förut..
Carro gick fint i traven, på tygeln,mjuka sidor o härlig... MEN hon hade glömt hur man fattade galopp xD så ja, det gick mindre bra.. host*
annars va hon riktigt fin idag!
Harry va lite stel, pigg o glad.. arbetade mest i skritt o trav, tog bara en liten galopp.. gick ganska bra :)

ska ta o driska lite te nu, sen duscha---> sova
känner att jag har mycket sömn att ta igen efter denna helgen, haha xd

hörs imån! o föresten... ni har väl inte glömt d HÄR?

//Erika


Hemma

Från Morfor och morfar! haft de toppen men nu ska ja sova, skriver om allt i morgon.

/emma


stallet väntar...

Sticker ut i stallet nu, ska ge hästarna luch,mocka 4 boxar o sen kmr Eve..
tar in alla storisar o rider två hästar today, Harry o Carro :)
Eve rider väl Jacky(som får börja trava idag) o Jerry bus ponnyn....<3
sen kanske kanske jag åker me henne hem sen o har en sleep over me henne o Tina.. men ah, inte bestämt än..'

har planerat in ett låångt inlägg om en ponny.. min ponny, som nu är Eves ponny
wait and see... det kommer, today or tomorrow..!

hörs sen!

//erika

nice picture... grymmaste tjejen-yaaa

//erika

lite nödvändigt

blev lite nytt o nödvändigt från Skara hästsport denna helgen--->


Kingsland jeansridbyxor


Animo vita ridbyxor med "enkla" snygga detaljer



Kingsland skjorta

//Erika

kommer ni ihåg..?

Ni har väl inte glömt de HÄR ?

gå med NU!

moorning!

uuuäääähhh,... goodmorgon!
har vart vaken en stund men gooosh va trött jag är! så dagen består nog mest av att chilla o slappa i soffan..
but first-------> frukost

ska lägga in lite bilder,skriva lite roliga inlägg o fixa nåra till d nya kategorierna.... som ni ser i högerkanten

Shopping 2011
Outfits 2011
Tävlingsoutfits

wiiihooooooooo... hörs later on!

//Erika

outfit GBG

Min o Harrys outfit på fredag i Göteborg..
jag är inte helgrym på sånt här men, aja.. ganska okay blev de väl?

hiss/diss till denna outfiten?

//Erika

lite resultat o sånt nice

hemma igen från en UNDERBAR tävling på grevagården! SM 2011 är avslutat.. puh
har gått riiiktigt riktigt bra för mej i helgen!

Khairo: 0 fel LA 5:a,4 fel Msv B, 4 fel Msv B pga avtrampad sko..suck, 4 fel msv B.. Har haft lite stolpe ut.., men va fasen.. han har varit skit fin!

Harry: 0 fel LA 4:a,4 fel LA skit pet, 8 fel DERBY 20 språng.. bank x2 stor bank med brant backe,pulvermangrav,trekombination,tvåkombination,uthopp,inhopp ja lite allt möjligt! riktigt nöjd!

Drömmis: 0 fel LA warm up, 0 fel KVAL I Msv B(stor, yees) 4:a av 43 starter, i SM! med 63,4 stilpoäng! :D riktigt glad! Kval II, sket sej totalt pga av att dom startade klockan när drömmis stannade för att bajsa.. haha ja.. låter kul men, jag fick panik, en total blackout o glömde allt! men skit samma, han va grym ponny! hoppade LA B-final o nolla again! tror nog ALDRIG att jag ridit så fort på drömnmis! svängde snäft,stor galopp,gasade,ja allt stämde helt enkelt! men, vad tror ni händer när det är två hinder kvar? joooo, såklart lilla gangster drömmis vänder o tror att det är slut, så att vi tappade typ.. hmm ja kanske, 7 sekunder? suck... men en grym avslutning!

Så jag är riktigt nöjd med hästarna denna helgen!
o vi ska inte tala om hur mycket vi ahr skrattat! helt sjuuukt! alla underbara boys and girls som har gjort att denna helgen har varit  h e l t   t o t a l t   g r y m !

o dom GRYMMA
medaljörerna detta SM blev:

B-ponny:
1. Ebba Larsson, Ard chuan Delight
2. Emma Rundcrantz ,Pablo
3. Adam Carey , Shangan Santana

C-ponny:
1. Jackie Georgsson, Ballyhar King
2. Sofie Ekestubbe, Cous Cous
3. Cornelia Saxentorp, Sceilig Siofra

D-ponny:
1. Joanna Johansson, Arkan
2. Antonia Pettersson Häggström, Shu B dee
3.Jennifer Johansson, Barrys Girl

GRYMT JOBBAT ALLIHOPA! RIKTIGT STORT GRATTIS TILL ER!

o särskilt till mina bästa tjejer, ANTONIA( our gästbloggare) o CORNELIA! Så galet glad för eran skull! ni är såååå värda detta! <3

Kommer en del bilder, o kanske lite filmer imån... nu skriker duschen..

hörs imån.. för nu ger jag mej.. jäääääsp*

//Erika


Helt grymma hästar helt klart!

Hej,tja,tjo,hallå på er! Sjukligt dålig update idag, I Know... Men tävlat all day long, me grymma ponnysar! In lastbilen Påväg hem nu... Har la typ 30 min kvar, yeey! lovar tt det kmr resultat,bilder o lite annat kul today/tomorrow! Proomise, hörs när jag kmr hem! //Erika

GÄSTBLOGGNING NR #4

Hej på er alla!
Fick förfrågan om att gästblogga här hos Erika och Emma, vilket jag var lite skeptisk till ifrån början .. Är så himla dålig på att skriva ihop texter såhär. Speciellt presentationer om mig själv.
Men jag ger detta ett försök!

Mitt namn är Isabella Villman och jag är 16år, börjar på Real Gymnasiet nu till skolstarten.
Jag bor med med familj på en hästgård i Landvetter, strax utanför Göteborg.
För tillfället har vi fem hästar.
Jag har min egna D-ponny Kiara och en utbildningsponny vid namn Sörbys Wilma. Lillasyster har två C-ponnyer, och så har mamma sin.

Kiara är född 1996, och jag har haft henne i 3år.
Tillsammans har vi inte hunnit göra så mycket då hon blev skadad efter vårat första år tillsammans, och hon blev sedan behandlad i perioder under ett års tid. Innan hon blev skadad tävlade vi upp till L:B, och det är där vi ligger även nu i dagsläget.
Några större planer tillsammans i framtiden har vi inte, utan det är mest bara att hålla humöret uppe på denna tjej.



Sörbys Wilma är som sagt inte min, utan en liten D-ponny jag har på utbildning åt Sammels Gård/Stuteri i Falkenberg.
Tog tog hem Wilma förra året i april då hon var 8år men endast riden i två år. Hon var mest riden dressyr, och endast hoppad små hinder med ryttare.
I maj gjorde hon sin debut på Clearround, 60cm. Och under denna korta tid har hon utvecklats något enormt och vi ligger just nu stabilt på L:A-nivå inom hoppningen.
Vårat tillfälliga mål är att starta MSVB till vintern, och sedan får vi se hur det blir i framtiden.


bild från förra helgen då vi tog hem andra platsen i SM för NewForest ponnyer!

Är ni lite nyfikna på att veta mera så finns jag på isabellaochsara.blogg.se där jag bloggar tillsammans med min goa vän Sara Fritzson! Även hon tävlar och har en storhäst och en D-ponny.
Bloggen är inriktad för vårat hästliv och där kan ni följa oss tillsammans med våra hästar - I både med- och motgång!
Har ni några frågor är ni välkomna att skicka iväg en kommentar på våran blogg. Vi svarar alltid på läsarnas frågor i inlägg, så du får garanterat ett svar om du undrar över något!

Då tackar jag för mig och hoppas att detta inlägget inte blev allt för tråkigt att läsa!
Glömt inte att kika in på bloggen! =)



_____________________________________________________________________________________

Tack så jätte mycket För att du ville gästblogga! Grymt duktig tjej med fin fina ponnysar!

//Erika o Emma

VM KVAL

blev nått fel vid uppladdningen så varje bild visas i typ 1 min istället för 2 sek.. men aja, ni får la ta o spola fram eller nått ;)


//Erika

hoppas...

Att ni gillar gästbloggarna som Erika har fixat!

Jag tycker dom har varit jätte bra!

Tycker alla 3 har varit toppen!

Alla rider super fint och är jätte duktiga!

Vi får väl se om Erika har ngn mer på gång, man vet aldrig ;)



/emma'S

tid för kvällsmat

Snart ska ja gå ner och käka kvällsmat. MUMMS
Blir grillat idag, igår vare kräftor, i loooove...

I morn ska jag till mormor o morfar, så räkna inte med top update!

Kan säga att min ponny va en DRÖM idag....helt underbar...



Favvo bild nummer 1 just nu...


/emma

<3<3<3<3<3<3


kanskekanskekanskekanskekanskekanskekanske

//Erika

provridning



sysselsättning på kvällarna.. HAHAHAHA xD

//Erika

GÄSTBLOGGNING NR #3

Heej allesammans :D:D Tack Erika och Emma för att jag får gästblogga häär ♥ Super kul!
Jag heter Louise Sjöqvist och är 14 år och är tydligen lika blond som Erika.
Jag har tre ponnys Independent Miss, Sunny och Ronaldo. Jag ska hoppa SM i helgen på Independent Miss eller "Misty" som hon kallas. Hon är 15 år och jag ska tyvärr sälja henne nu.... Sunny är 13 år och är tyvärr skadad... Älskar henne och hoppas hon snart är frisk ♥ Och Ronaldo är en knäpp ponny som är lite speciell ;);) Han har lärt mig huuur mycket som helst sen jag fick honom för typ 2 år sen :):) Jag rider varje dag och älskar att tävla och att få träffa alla knäppa hästmänniskor jag känner :D:D ♥ Typ Erika, haha ♥
Jag lärde känna Erika för typ 2-3 år sen. Kommer inte ihåg hur men jag vet att vi dansade med sopkvastar :D:D Cornelia Saxentorp va inblandad i detta vet jag ♥ haha :):)
Emma dig känner jag inte så bra men du är super sneell :):) ♥
kram på er <3

Louise

_______________________________________________________________________________________

En helt, sjukligt söt,go,fin,ond,härlig tjej.. som faktiskt är min fru sen 1 månad tillbaka..

//Erika

Harry hoppar vattengrav, inföör Swedish mastership


ehm, ja det är pappas finger som syns i bild.. aja titta på fina hästen<3

//Erika

Bling,bling,bling hear me sing,sing,sing
















Eehm, ja.. som ni kanske ser... jag äälskar blingblingblingbling!
alla saker som har minsta lilla strass,swarovskisten, bling sak, ja ni fattar- allt!
detta är vel typ hälften av alla bling saker som finns i stallet, haha xD

vad tycker NI om bling saker? hiss diss?

//Erika bling Wenderyd

ganska trött, men taggad som tusan!

Sm kval II, LA DERBY, Msv B..... dagens klasser yeeah
taggad till tusen! hästarna känns super fräsha.. nyklippta o fixxade ut till tårna
så nu sticker jag bort till stallet!
håll tummarna för mej, eller?

//Erika'

Lite reeesultat for u

Sorry för att jag inte har skrivit resultat, men u know... Im With friends, undeerbart! Aja, lite kortfattade resultat: Khairo: LA torsdag 0 fel 5:a, fredag Msv B, grym.. 4 fel, skit grej men grym ponny! Harry: LA torsdag 0 fel 4:a, LA fredag 4 fel, skit pet men super fin! Drömmis: gaaaaaaaaaaaaaaah!!!! Torsdag LA warm up, 0 fel, kval I... Msv B,0 feel!!! Ååååh så underbart! Kom 4:a i stilhoppningen, som det var idag... Fattar ni, 45 av Sveriges bästa ekipage o vi kom 4:à i kval I stil!! Är riktigt nöjd! Festen va awsome, skrattat massa ,.. Dansat på scenen... Med en kvast o vännerna, sjukt roligt! Nu ska ja sova, tagga Msv À kval II, Msv B o LA imån... Yiihoo! Hörs imån! Kram Erika

kvällen är här

rryyttarrfeest nuuuu, helt grymt yeeah!
hoppas att kvalet gick bra idag, i så fall firas d nu!

hörs imorgon, its time to have fun! sm 2011- is the best, av dom alla- helt ärligt!

//Erika

Bilder från Ulricehamn!



--> flygande ponny?!



ÄLSKAR bilden!

Den bara utstrålar GLÄDJE.

Älskar min ponny.


//emma'S

Teknik, svårt att se skillnad?

Jag har märkt att det är många som tar fel på teknik och att hoppa högt över hindren..
så här kommer ett inlägg, som förklarar vad en bra teknik är:

En bra teknik är när hästen sänker huvudet o lyfter knäna ovanför armbågen.
Men många tror att en bra teknik är när hästarna hoppar högt över hindren, men där tar dom fel!
Hästar som hoppar högt över hindren men med slappa framben, gör det bara jobbigare för sej själva!
En häst som hoppar med höga knän o med sänkt huvud gör det lättare för sej själv,..

Men sen är det ju så att bara för att en häst hoppar med en BRA teknik(bild 1.) så betyder det ju inte att den hästen är bättre än hästen som hoppar som teknik 2., men den gör det på ett enklare o bättre sätt...
o en häst som hoppar med hängande framben, kan man träna upp till en bättre teknik genom att hoppa mycket studs, markarbeta/dressyr arbeta mycket så att hästen blir starkare o orkar dra upp frambenen högre o snabbare!
så om ni ser en häst som hoppar med hängande framben, men högt över hindren, så är det inte någon "bra" teknik
men om ni ser en häst som hoppar med uppdragna framben, o sänkt huvud så är det en häst som hoppar så kallat "ekonomiskt" o med en bra teknik!

många hästar som hoppar med en "bra" teknik gör det för att dom är otroligt rädda om benen, vilket är positivt!
men det kan oxå göra att dom "överhoppar" sej, vilket betyder att dom hoppar lika högt som bild två, men med samma "bra" teknik som bild ett...
hästar som hoppar på det sätter är ofta unghästar o oruttinerade. På låga hinder så kanske det inte spelar så stor roll, men när man sedan kanske höjer så kommer ju hästen att hoppa ännu högre över hindren, o det kan göra att den blir "rädd" för sej själv om ni fattar vad jag menar..? Den tar i så mycket, o när det blir högre så tar den i ännu mer, o detta kan leda till att hästen tillslut "ger upp" o tycker att hindren blir skyhöga, o vågar därför inte försöka!
om det skulle komma till den situationen att hästen blir rädd o börjar stanna, så är det bara till att jobba upp självförtroendet igen , med låga hinder o bommar framför.. o när hästen har "kommit ner på jorden" så att säga, o inte hoppar riktigt lika högt över hindren länge, mer "ekonomiskt" så kan man försiktigt börja höja igen, så att hästen känner sej trygg!


hoppas ni förstog vad jag ville få fram genom mina konstverk.. host*

//Erika

Jag e så stolt....

..Över erika! Hon är ju helt sjuuukt bra!
Att få va hennes vän e gryyyymt!
Kan ju inte säga mer än att hon va så J*VLA GRYM idagens kval! Drömmispojk va aaaaaas fiiin han oxå!
Så kul o se dom , för dom e så samspelta!

Så ja avslöjar det, dom va NOLLA :D

Så här får ni bilder på dom från idag, kommentera riktigt mycket nu så blir hon säkert glad :)

(och räkna inte med super bra bilder, ja va jätte nervös o skaka o allt o ja XD)










Ni får mera bilder när ja kommer hem igen, ska till stallet nu !


//emma'S

BLOGGTÄVLING!

BLOGGTÄVLING!!

Nu drar vi igång en utlottning/bloggtävling!
Vi kommer att dra TVÅ vinnare, när Erika kommer hem från Grevagården.. så gå med nu!



Det du behöver göra för att vara med i tävlingen är att:

1. Länka oss på din Blogg/hemsida/Facebook/bilddagbok
2. Komentera detta inlägget med varför just DU ska vinna!

så passa på att vara med nu, o vinna en EXKLUSIV HORSE WEAR LUVA!

Vinnaren, den vi drar först i lottningen, kommer att få välja fall den vill ha brun eller blå luva.

//Erika o Emma


I bilen på väg mot......

..... Grevagården! Jag och mamma ska dit o kolla lite idag. Självklart ska jag hejja på Min duktiga vän Erika! Och en i mitt lag som heter Annie! :D dom e grymma ska ni veta! Träffar även Ella där, så hon får sin kamera och lite saker hon glömde ;) Juste, haha måste bara säga en sak till.... KLANTIGA JAG! jag tappade min macka i marken på väg till bilen så ja satt o pilla med den jätte länge och när jag skulle ta första bettet så knastra de i hela min mun xD USH! haha så va de me den mackan.. -.- haha xD Ozzy hälsar oxå att han är livsfarlig! XD XD /emma'S

SM börjar, nuuu

uppe, tidigt.. såklart d är ju tävling- woop woop
sm drar igång på riktigt today.. kval I fel o stil Msv B.. taggad, yeeah
Khairo Msv B idag, Harry LA.. känns super!
ikväll blire ppaarrttyy.. wiihoo!  Tror nog att ryttarfesten denna gången kommer bli riiktigt nice!
taggar inför allt nu, känner att allt är på topp, livet leker
så, nu kör vi!

//Erika

mla tider, sämre tider.. för vi lever i nuet..yeey

Mobil bloggning

Bloggar vid halv 8 i morn.. Ska till SM o heja på Erika (som de har gått as bra för) och lilla Annie! Tar med mej min hel galna hund... Så akta Er xD Nu ska ja sova , hörs i morn. //emma'S

Ppaartyy*

FESTHOSMANGEFESTHOSMANGE NUUUUUUUUUUUU!

är me de bästa, hörs imorgon, kram

Erika

cornelias nya pålle, starlight X2000


täävling

imorgon, drar SM igång på riktigt.. men oxå en ny bloggtävling..
vi kommer lotta ut två, riktigt snajjsiga priser.. o dra TVÅ vinnare..

så håll utkik nu, för snart.. drar det igång

//Erika o Emma


in sköövde yeesh

sitter som ni vet, i Skövde, i min lastbil... o undrar.. vad tycker ni om gästbloggarna?
..........
o ja, har hoppat förklassen nu.. LA med alla tre, resultaten kommer-promise!
men nu ska jag dra o putsa,fodra,mocka,leda,linda,o ja ni fattar.. lite stall fixx

hörs sen, med resultat!

//Erika

GÄSTBLOGGARE nr 2

Heeeej på er, alla siiimplythebest läsare.Erika frågade om jag ville gästblogga, why not? :):) Jag heter Jenni, bloggar på <a href="http://www.teamlabom.blogg.se/">www.teamlabom.blogg.se</a> en blogg följer mitt liv runt hästarna och i vanliga livet. På tävling - till vardags. I Motgång - I framgång. I sol och regn.... Jag, Jenni Linnea Camilla Bloom, är en 94, bor i ubbhult (5 minuter ifrån Erika) med min mamma&amp;pappa och ibland min bror. Jag har en D-ponny valack, connemara, född 2001, import Irland vid namn Flint Grey, lite långt att säga så vi kallar honom helt enkelt Flinta. Sen har jag en b-ponnytjej som heter Fia som är en glad pensionär och går som sällskapsdam till Flinta. Jag och Flinta tävlar upp till LA hoppning just nu, siktar på Msv nångång nästa år. Jag ska börja andra året på Sveriges Ridgymnasium efter sommaren.När jag var 11 år gammal träffade hon Erika for the first time, jag fick komma till deras stall och borsta och pyssla med erikas små ponnysar Fia och Putte. I början va jag själv i stallet, det va den bästa dagen på veckan eftersom jag totalt älskade hästar men rida kunde jag inte, borsta och gosa räckte bra för mej, jag såg alltid fram emot att få gå av bussen hemma hos Erika och vara där hela eftermiddagen och bara vara.... Efter ett tag började Erika vara med mej i stallet och vi hade väldigt roligt ihop, vi började umgås mer och mer och tillslut även utanför stallet och när Erika fick en ny b-ponny som hette Fonzie fick jag börja rida Fia några dagar i veckan. Jag och Erika drömde om att ta över världen med Fia och Fonzie! Vi skulle tävla hoppning, köpa en lastbil, bli kända...! Vi tränade gymkhana...utan nånstörre framgång, åkte på våran första clear round, lekte nästan vaaarje dag, lärde oss rida tiillsammans, åkte på våran allra första tävling ihop, åkte på ridläger och ja, vi gjorde nästa allt ihop och vi va verkligen bästisar, vi kallade varandra för systrar på den tiden! Sen när Erika fick sin nya ponny Maja fick jag börja rida Fonzie, men jag va ju 12 år då och b-ponny va lite litet för mej och såsmåningom tog mamma&amp;pappa beslutet att jag skulle få en alldeles egen ponny. Då dök Irish Harmony upp hemma hos oss. D-ponnyvalak kallad Hasse, då 15 år gammal, import irland, startad LB med föregående ägare Cecilia, tidigare startad upp till Msv hoppning och samtidigt kom Fia hem till oss med, sällskap till Hasse eftersom Erika hade andra ponnysar och Fia var väl ingen stjärna på tävlingsbanorna direkt.... Hasse var en ponny som gjorde allt i 110 knyck - pigg, het och studdsig - men som vi märke senare, så va han inte allt för rolig i hoppningen, han var en riktig stopper. Vi kämpade på några år men gav upp eftersom han kunde vara riktigt ful och dum. Då hittade vi en enormt biffig, kritvit skitponny vid namn Flint Grey i ett försöljningsstall i landvetter. Connemara valack, född 01 altså 7 år då, precis kommit in från Irland. Oriden, lat, ouppfostrad och allmänt skitjobbig! Men en riktig klippa i hoppningen, hade starter till MsvB+5 som 6-åring. Styrde man mot ett hinder så hoppade han, visserligen i hans egna, sävliga takt men han hoppade, no matter what! Jag föll pladask för Flinta, jag brydde mej inte om att han va som han var utan jag föll för hans personlighet och han kanske va oriden och jobbig men han tog ändå hand om mej... Så vi köpte honom och i agusti 2008 (?) om jag inte minnst fel så kom han hem till oss.Det blev mycket jobb, slit, svett och tårar med denna ponnyn. Hade jag köpt en ponny nu hade jag aldrg köpt Flinta, jag hade fattat att det var alldeles för mycket jobb för dom pengarna vi fick ge men nu är jag väldigt glad att det va Flinta och ingen annan som vi köpte. I början så va allt väldigt svårt, Flinta och Hasse var som dag och natt verkligen och jag fick verkligen kämpa på för att lära mej honom och vi tränade på och när det väl började ta sej, efter ett år eller nått när han äntligen började bli mer välriden, alla olater var borta - han bockade inte, han drog inte ner i huvet i marken, han sköt inte ut bogarna i varende sväng och gick dit han själv ville, han hade slutat bitas, kunde äntligen stå på gången, det gick att lasta honom, han gjock i form och va välbalanserad och fin, han va snällare, smalare, gick mycket bättre och jag red mycket bättre så blev han halt - hovledsinflammation. Han hade boxvila i nästan 1 månad, fick gå i sjukhage länge och det tog många, många månader innan vi var igång igen. Då va det lite som att börja om, vi hade tappat så gott som allt. Men vi kämpade på och tillslut började framgångarna komma. Vi hade nästan alltid nån rosett med oss hem på nästan varje tävling under det året, Flinta va långt ifrån snabbast men han kunde svänga och hoppade no matter what så han va en bra ponny i omhoppningarna och vi hade väldigt roligt tillsammans. Jag och Flinta har bara nästa år kvar på tävlingsbanorna nu, men vi har kommit väldigt lång ihop. Det får man faktist säga. Från att inte komma runt LD, hoppa 60-70 cm banor med 4 eller 8 fel som bäst, rida som en riktigt kratta, inte kunna gå i form eller ens fatta galopp, bitas och vägra lastas - har vi nu kommit till att starta LA och sikta Msv, Flinta är välriden och snygg, jag rider 1000 gånger bättre och har blivit tuff av allt slit med honom, han är snäll som en ängel och den mest väluppfostrade ponnyn man kan hitta och efter allt vi har gått igenom så har vi blivit väldigt tighta, Jenni och Flinta är lika självklart för mej som Pippi och ;Lilla gubben, lika självklart som att gräs är grönt på sommaren. Och jag och Erika, vi är fortfarande väldigt bra vänner även om vi inte ses så ofta, jag vet att hon alltid är en vän att lita på och jag älskar denna tjejen grymt mycket!!!!! ♥ och diggar hennes och emmas blogg, hoppas ni med gör det!! :)Och glöm inte att titta in på min blogg med, <a href="http://www.teamlabom.blogg.se/">www.teamlabom.blogg.se puss på er//Jenni





__________________________________________________________________________________________

Grym tjej, great pony and a great story <3

//Erika o Emma

Gästbloggare nr 1

Hej alla läsare! Här kommer min gästbloggning!

Jag heter Inez Örneborg och jag är 15 år gammal. Jag bor i Fjärås med mina två föräldrar och min syster. Vi bor på en gård med både ridhästar och travhästar. Min farfar och farmor bor också på gården och det är dom som har alla travhästar!
Jag har tre stycken ponnysar. Två C ponnyer som heter Dr Giggles och Alex. Alex och jag har två SM guld, en 7:nde plats i globen och massa placeringar upp till Msv A. Han är nu 21 år gammal så han går inte så mycket Msv A längre. Sen har vi Dr Giggles som är 17 år gammal. Vi deltog i Nordiska mästerskapen detta året. Då fick vi ett silver i lag och en femte plats individuellt. Vi har varit i skandinavium och ridit GP ponnyn! Innan jag hade honom så red min syster honom och dom hade oxå två SM guld . Fast på lag sm i strömsholm och dom hade också ett silver i NM laget och en fjärde plats individuellt. Jag och giggles har oxå många vinster i msv a.
Sen har jag en D ponny som heter Strattonstown Nearly Gone och är 8 år. Med honom har jag ett brons i ungponny SM och vi har precis börjar hoppa msv a med placeringar. Han hade elin oxå innan och dom hade ett Sm guld i ungponny oxå!

Just nu så är båda mina c ponnyer till salu , om det är någon som är intresserad. Så efter det ska jag köpa en juniorhäst och så ska jag oxå ha kvar min d ponny som jag gärna vill hoppa något stort på nästa år. t.ex som EM eller NM!
Så vi får hoppas att det går bra.

Erika och jag har känt varandra ett tag nu och vi har alltid lika roligt ihop. Så ifall du känner dig nere så är det bara att ringa bästa erika wenderyd, för hon muntrar alltid upp en. Erika är den roligaste och den goaste person jag någonsin har träffat och jag saknar dig otroligt mycket och jag kan knappt vänta på att vi ses på SM nästa helg!

PussPuss! //Inez Örneborg!
__________________________________

Tack sötaste Inez, för att du ville blogga här on våran blogg! Grym tjej, grymma hästar o ett grymt liv <3

//Erika o Emmma

sm morgon

uppe nu, men fick lite sovmorgon.. underbart
ska käka lite, sen drar jag till stallet o tar hand om mina ´överfina hästar
ska skritta ut lite, mocka,o lite sånt där allmänt fix u know, mys..

tävlingarna börjar inte förens i eftermiddag, med en förklass i LA
ska hoppa den med alla, så att man kommer igång lixom o har sett banan o´alla hinder

har ju vart här förut massor av gånger men, aja.. tävlingsplatsen är jätte fin!
riktigt snygga hinder,två ridhus,två paddockar,två gräsbanor and lots of stables!
fast har aldrig tävlat på deras grusbana, så d blir lite nytt!
på lördag hoppar jag Derbyt med Khairo, kanske harry men iaf Kaktuss.. LA+5, på gräsbanan.. med massa hinder som typ bank,vattengrav,pulvermangrav o you name it!
ska bli riktigt nice faktiskt, taggar till tusen!

vi hörs later on!

//Erika


Vännerna nu

är med some riktigt grymma friends.... har d, så hörs vi sen!

//Erika


lastbilen

sitter i lastbilen, o den här gången bär det av mot Grevagårdens RF, ponny SM 2011

taggataggataggataggataggataggataggataggataggataggatagga

//ErikA

nu drar jag!

packat o klart, nu bär det av mot sm 2011
wiihooo!



//Erika

tyväär inte än..

Vi fick ju en fråga om vi kunde fixa ett videoinlägg där vi filmar vårat stall/paddock/ridhus o så.. o jag lovade att den skulle komma upp i helgen.. tyvärr, så vill inte youtube o min mobil sammarbeta.. så filmen kommer när jag kommer hem från sm!

sorry, men det finns inget annat att göra..

//Erika

09.19

Fixxat massa inför helgen, o då menar jag inte hästsaker eller paackning utan bloggen.. inlägg
har ingen koll alls på när dom komemr ut vad det är för inlägg eller någonting.. har glömt av fullständigt vad det är jag har fixat xD
men aja, d blir ju spännande att se iaf.. ;)

käkat frukost nu, yammi.. ska packa mina väskor nu.. ja vet.. jag skulle gjort det igår men klockan blev rätt mycket så ja tänkte att jag gör det nu..
sen sticker jag ut i stallet, rider alla o packar klart..! skyndaskyndaskyndaskynda
puh*

ni får helt enkelt se fram imot inläggen som kommer, för nu måste jag dra!

önska mej lycka till

kram på er, så hörs vi.. lite varje dag med resultat o så.. självklart!

//Erika


morgon stress

cha på er!
vaknade precis, har massor o göra o en frukost som väntar.. så jag är ledsen men.. I had to go!

hörs senare, förhoppningsvis!

//Erika

tack för hjälpen Zorro!

Inne för kvällen, stallet är fixxat.. hästarna har fått mat.. alla är ridna o ja, grymma som vanligt <3
har packat täcken o schabrak klart idag.. ska fixxa min väska nu, eller mina väskor..
behöver ju en del kläder med mej!
rsten av packningen gör jag imorgon, skåp o allt sånt.. rider nog alla hästarna här hemma innan vi åker vi
5-6, on eftermiddagen..
Ella komemr runt halv fem o hänger med oss i lastbilen till skövde, hon ska bo hos Tove tror ja o bara glida runt på sm:et, härligt med lite sällskap <3

som tur va fick jag hjälp med packning idag av min otroligt hjälpsamma KATT... xD


natti!
//erika

skynda som vanligt!"

Går ut i stallet nu, fixar ett videoinlägg som komemr upp till helgen, rider två hästar o börjar packa.. klockan
är 20.25.. kanske dags att börja fixxa lite nu? eller vad tycker ni?


skriver mer ikväll, lovar!

//Erika

jahopp

Ibland är livet svårt, man vet inte vad man ska göra,ingen finns där för dej, allt är jobbigt
O ibland är det så J*VLA BRA! woop woop d går bra nu!

//Erika

ååh, hur länge höll det? vänta lite ska se...hmm.. exat två timmar kanske?


sometimes it hard

Ibland är livet svårt, man vet inte vad man ska göra,ingen finns där för dej, allt är jobbigt
O ibland är det så J*VLA BRA! woop woop d går bra nu!

//Erika


it's raining, suprise!?....NO!!!!!

Har trick tränat ozzy idag, fy fasen va han e bra!

Får ta o visa de ngn gång, för han lär sej skit fort..

Idag ska jag rida ett markarbetspass på Cooper, de kan han behöva o bli mjuk oså! :)<3

Bloggar mkt mer ikväll, då det inte händer mkt just nu.

/emma'S



Haha lite stor pinne kanske Ozzy?! XD



yammi

Sticker till farmors restaurang o käkar,,.. hörs later on!

eehhm.. jaaa....?

//Erika

försov mej igen,hehe

uppe- två timmar för sent.. hehe*
klockan ringde 3 gånger.. jag somnade om tre gånger, smart I know
men nu är vi uppe, frukosten är klar.. så stallet väntar, mocka 6 boxar o rida 2 hästar- sen freedom

kommer spendera dagen me Eve, en del av dagen iaf.. awsome!
åker med mamma till Kungsbacka o handlar mat o så inför sm i eftermiddag... sen ska jag rida två hästar till o börja packa.. räätt mycket saker nu som ska me- yepp

kommer en del roliga filmer, om youtube vill sammarbeta, i helgen o även.. en liten sak för er läsare.. så håll koll!

//Erika

dags att dra sej, mmh

Ridit världens bästa hästar
gick grymt bra med alla, hästarna känns galet fräsha.. underbart!
o nu ska jag sticka ut i stugan med världens bästa vän.. Evelina <3
myys, men först, föresten... te framför TVn.. sååklart!

ha en grym kväll, så hörs vi imorgon!



svar till Maja

Postat av: Maja

Kan inte ni vissa stallen, ridhus(om ni har) och så i vidoinlägg

2011-08-08 @ 18:25:23

Hej Maja!
Självklart kan vi de! Jag fixar en videoblogg imorgon, som kommer upp till helgen.. under dom dagarna jag är borta :D

kram
Erika

in my head,..

mitt huvve är överfullt... av dej
vill dela med mej av mina känslor men, vågar inte,vill inte.. bli sårad
önskar att du visste hur det var, hur jag känner.. hur jag vill ha det..men så kommer det aldrig att bli
vi lever i skillda världar.. jag finns inte i din.. men du tar en massa plats i min
suck*


Långprommis med vovven

Kom precis in nu.
Vart på lång promenad med ozzy, så han fick busa av sig i skogen!

haha han e ganska trött nu xD

ska nog till stallet snart, joggade cooper igår, han va super fin som alltid<3




//emma'S

skicka iväg nått, går snabbt serru

statestiken stiger, ni är på topp.. men var är komentarerna?

Ut nu, vi hörs sen!

ut i stallet nu, work all day... nästan iaf..
Hörs later on, <3

Hoppas att jag lever, med tanke på mina hästar, hm.. ja som ni ser.. ibland förvandlas till människoätande monster......

//Erika

mrning o nya saker

Gårdagens små iköp....

*Ear cuff
*Halsband med kors
*örhängen som kors
*Brunt skärp
*Gula byxor(Gular i verkligheten)

Känns kanske lite som att jag är en shoppaholic, but no... bara en vanlig tjej som gillar att köpa saker.. xD
________________________________________________________________________________________

Nu hoppar jag in i duschen, eller går gör jag nog... Sen frukost..
ska ta o fixxa i stallet idag, står nog för den mesta mockningen..10 boxar..yepp
sen så ska d bli lite stallstäd, får nog kanske lite hjälp av eve när hon kmr ikväll, hoppas jag
tror nog att jag ska rida alla hästar idag oxå, 4-5 st + att mitt rum noog behöver en liten putsning kanske.. ehmm
dagen är full, som vanligt..

vad gör ni idag?

//Erika

My dream, my life

Hacka inte på mig, säg inte åt mig vad ska och inte ska göra.
För de e inte ditt liv?
Jag ska leva mitt liv till fullo.
För man lever bara en gång, right?
Ta vara på det.
Och för guds skull tryck inte ner andra personer.
Livet är för kort för att bli arg på människor..
Var glad, låt dig inspireras av folk, o inspirera andra.
Hjälp andra, o låt andra hjälpa dig.
Se inte o tro inte att du är värd mer än andra.
För det är du inte, vare sig du är miljonär eller inte.
Eller tro inte att du är mindre värd än någon här i värden för det är inte sant!
ALLA är precis lika bra, vare sig man har vunnit OS eller samlar på frimärken..
De spelar ingen roll, om du är topp modell, eller en basket spelare.
ALLA är lika bra.
ALLA har sin egen grej.

Tro på dej själv, för om du verkligen vill och bestämmer dig, så KAN du.

Ge ALDRIG upp, bara för att du stöter på några människor som inte tror på dej o trycker ner dig.
LYSSNA på dom som uppmuntrar dig och ta åt dej, för i slut ändan är alla lärare.
Dom sätter ju dig på prov,..vill du det tillräckligt mycket,  fortsätter du trots motgång.

Och Insidan räknas mest, tycker jag.


JAG har mina drömmar och mål, och jag ska kämpa för att komma dit.
Jag ska inte ge upp, motgångarna sätter mig bara på prov o testar mitt tålamod.
Vill jag verkligen detta?
Svar: JA.

Jag ska inte ge upp.



Jag vet att jag kan, jag vill o jag SKA.







Jag o Conny pojken i vintras<3



/emma'S

massa fix, no bloggning.. sry

godnatt<3

//Erika

Kolla..

Kolla denna tjejens blogg, hon är sjukt stark och tar inte emot skit.
Hon har även min första ponny Curry, som för tillfället är skadad..stackarn<3

Om det fanns fler som du skulle världen vara en bättre plats.

Klicka
HÄR

/emma'S


Cooper mitt hjärta

Utan honom, är jag ingen.
Med honom, är jag någon.
Han gör mig hel.
Han är min andra halva, som jag länge har letat efter.
Ingen kommer någonsin att förstå hur mkt jag älskar denna lilla ponnyn.
Han ger mej mer än vad ni någonsin kommer kunna föreställa er.
Han ger mej styrka, o ger mej mening att fortsätta kämpa när jag mår dåligt o allt är skit.
Om något händer honom, lovar jag er att då går jag i bott.
Då finns det inte längre någon mening att kämpa.
Då finns det inte längre en HEL Emma sahlberg.

Jag älskar dej min underbart vackra vän, de e föralltid du och jag.




/emma'S

på väg upp nu

fixar filmer, hold on <3

//Erika

??

suck inte igen.....varför?

//Erika

Omotiverad...

Har världens bloggtorka känner jag...
Inte alls motiverad,

Ni får börja kommentera bättre, o ge förslag, det är då vi får kraft o bloggar mer.

För vi väljer ju att dela med oss av vårt liv till er, då får ni peppa oss lite oxå.

Känns inte jätte kul annars...

//emma'S


kungsmässan, yeeey

hemma från Kungsbacka nu, blev lite småshopping, även om d inte va meningen,.. hehe xd
bilder komemr sen, om ni vill se?

nu ska jag ta o käka lite, sen sticker jag ut i stallet o rida one horse, and help my dad in the stable a few minutes.. yepp, så får d bli
Eve kommer sen vid 5, o rider Bruno(woow) o Jacky, jag rider Kakan o Carro.. Harry rider jag ikväll
ska nog ta o hoppa lite, maby blir det film ikväll, om mitt underbara bästaste grymmaste youtube vill fungera..
gaaaaah@@@@@@@

hörs later on, me bilder.. o maby filmer

//Erika W

min monsterkatt<3 ni ska få se, en film.. på hur oootroligt mysig han är.. hmmm

morgon igen

morning!
regnet faller, himlen är grå,ute är det kallt,,... o här sitter jag med en stor pälsfilt..
myys, på hög nivå!

Dagens schema:

*Fruuuukost
*rida storhäst
*åka tll Kungsbacka
*klippa klart drömmis
*rida Kakan
*rida Harry
*rida Drömmis
*städa stallet/inne

dagen är fullproppad, så snacka om att man får plarea sin tid xd'
men, no segande bara så blir d bra, mmh.. jo det blir det

idag är det söndag.. SÖNDAG
på onsdag åker vi till utomhus SM 2011, gaaoosh
bara 4 dagar kvar, tills årets största händelse, snacka om att jag är taggad eller? lätt att jag är!
Alla vänner, spänningen, årets roligaste/största ryttarfest, hästarna, luften, allting är bara helt grymt!
o Drömmis är nyklippt,pigg,glad,taggad,gaalet fräsh,ja menar.. senaste tävlingen i Ale,,. Msv A, helt klockren!
så det känns toppen inför årets tävling, faktiskt
tar med mej Harry o Kakan oxå, hoppar en cup som går gämte SM:et, i LA-Msv B eller nått sånt.. har inte riktigt koll xd

är borta ons-sön... men jag kommer nog kunna blogga lite på plats, m datan vill funka..

hoppas ni håller tummarna för mej wish me luck!

//Erika

skoltankar

drar mej till duschen, sen sova.. sjukligt trött
middagen, eller kvällsmaten(?) va  grymt snajjsig! mumsi'
chattade me lite grymma människor som är galet saknade, typ ja, ni två.. Matilda Sparrenhök<3 Alma Ahlbäck<3

känner att mitt sommarlov bara har runnit iväg, har inte varit me nåra andra vänner än rid o tävlingskompisar.. sjukt ju! Menar inte att d inte är roligt, för tävlingar,meeting,vännerna där,allt med hästarna.. finns inget bättre, lovar! det är när jag kommer iväg, är med hästarna o gör allting runt om.. som jag mår som allra bäst! men jag  känner att jag har sååå många mer saker som jag vill göra, men ingen tid.. suck
jag lever mellan tävlingarna, jag räknar tid mellan tävlingarna..o så fort jag kommer hem från en tävling, så börjar jag förberada mej för nästa
känns som att jag aldrig har tid, o när jag har d,.. så ja, som ni märker-så segar jag ofta bort den ;)
har massa mer folk jag vill träffa, liseberg me massa goa,bio,stan,shopping,fika o gaah
men ändå, faktiskt.. så tycker jag att det ska  bli roligt att börja skolan igen,,.. kanske låter sjukt för vissa men det är sant, jag har SAKNAT allt, alla grymmaste vänner,alla goa skratt,alla mysiga pratstunder, o faktiskt.. lite plugget me... oops
jag är galet taggad inför skolåret faktiskt, jag kanske håller på att bli galen? aja, whatever jag mår ju bra ut av det iaf ;)
hade bra betyg förra året, måste ändå säga d..men nu, nu har jag motivationen, jag VILL, o jag ska plugga allt jag har o kan, o få det att gå ihop med 4 hästar.. aja d blir säkert bra! xd
så ja, jag säger detta... jag längtar tills skolan drar igång igen..ojoj

//Erika

2010 skolavslutning.. shiit va annorlunda allt är nu, yepp

3/4 klippt, nya modet? xD

inne från stallet nu, puh
hästarna gick toppen idag!
Skrittade ut Drömmis med eve o jacky, mys såklart
sen red eve Jerry o Jag Kakan..
Haha började med att göra ett upphopp på Jerry, rätt stolt över att jag har lärt mej d nu xd
sen red vi vanligt markarbete på båda, såg ut som att jerry va riktigt lugn o fin, gick mjukt o avslappnat
o Kakan va överfin som vanligt! min kille<3

ska sticka ut o ta in jacky o Embla nu, sen käka middag xD
som vanligt, vi är rätt sega

O klippte Drömmis idag me, hmmm,,... han inte klart för batteriet dog, så nu är han 3/4 klippt xD
hahah hela rumpan på ena sidan är kvar, så jag skämdes lite när vi red ut.. haha
Sussie va så snäll att hon kom hit o klippte Harry, behöver ju ett proffs för sånt vettni
blev jätte bra, eller det jag såg blev väldigt bra iaf!
hörs later on, o hoppas på att mina käraste vill sammarbete!
för ni vill väl se mej o Conny kvala till VM?

//Erika

allt idag då

@@@@@@@@@@@@@@
filmerna vill inte, försökt i hm.. 2,5 timme nu? gaaah
men jag lovar, så fort mitt kära youtube funkar igen, så kommer dom upp direkt, here on the blogg

jag kan iaf säga att dom gick super, båda två!
red Conny o Carro på morgonen/dagen.. hoppade lite med båda..
O jag o Conny, vi,,.. vi kvalde till VM
yepp, det är sant, film bevis komemr sen!

Hoppade Carro lite på nåra linjer, trångt för att få kontroll o kunna ata tillbaka henne, gick grymt bra
sen hoppade vi en oxer nåra gånger, lite högre.. 1.40 drygt faktiskt..! rätt stolt, första gången hon hopapr så högt(o jag med för den delen)
så jag är riktigt nöjd med båda!

nu städar jag mitt rum, o hur roligt är inte det? hmm..
*
Eve är här om typ, 2 minuter, så då rider jag Drömmis o Kakan med henne
oj, J*klar... jag har bara klippt halva drömmis ju.. ooops

måste rusa xD

//Erika

du gör allt för att förstöra för mej!

 du bara sviker mej gång på gång!
jag trodde att vi lyckats, tillsammans.. men precis innan målet är nått så ger du upp,lämnar mej i sticket, SVIKER
nu ger jag upp, hittar någon annan....</3

youtube, nu är det inte du o jag längre!

//Erika


youtube sammarbeta!

filmerna är på väg upp, hold on

//Erika

RESULTAT!

Kan ju bara börja med att säga att jag är HELNÖJD med dagen..

LC 0+0 fel 

KLOCKREN, finns inget o säga, allt satt perfekt, han lyssna tillbaka, och vi drog på som fasen i omhoppningen hahha XD
Så jag VANN denna klassen, fick segertäcke o allt, bästa ponnyn<3


LB 8 fel

Han kändes fin oså, men JAG klantar mej så vi hoppa IGENOM 4:an typ XD o sen SLARVADE han på 5:an, så de peta han med bakbenen. MEN känslan förövrigt va väldigt bra! Så absolut ingen katastrof runda :)
Hade ja inte fått avdrag så hade ja fått 57 stilpoäng, o nästa gång ska ja fasen få 60, de e mitt mål!


Så dagen har ju varit super, jag bara log när jag o cooper vann, jag startade sist, o när ja gick i mål sa dom :

"Och Emma du kan stanna på banan för vi fick nu segraren i klassen"

Då log ja , kan ja säga.

Jag har världens bästa ponny, o jag är så stolt över honom.

Vi har nu 4 segrar, på 4 månader.

O massa placeringar.

Han e sjukt bra, min ponii.




Bilden är från idag, på min prins





//emma'S


Ovisade bilder från Askim!

Här e nåra bilder från Askim!






//emma'S

woop woop

suck
jag är alltid så trött på morgonen, o humöret på topp.. ajabaja xd

ska ta o sticka ut till min storis om en stund o hoppa(?) tror jag, eller markarbete..., inte säker
sen ska jag fixa lite här inne o hjälpa mamma, yippie!
ska rida alla idag, Eve rider Jerry o Jacky, jag rider Dröm,Kakan,Harry o Carro.. as usual
o lite lugnt därimellan,.. o ladda upp xd
 så sjukt tråkigt väder, ja menar.. det är ju sommar o snart börjar skolan, kan vi inte få liiite sol nån gång?
regn har vi fått nog av, eller jag har det....!

Emma är o tävlar all day in Ulricehamn, så blir nog ingen update från henne under dagen..

men ni klarar väl er med mej? xD
oooo mamma sa precis, nu for just a second ago, att jag ska klippa drömmis idag,.. oh my
jag har ALDRIG  klippt innan ju! :o
o nu när han ska vara sm fin, wooohoo
men, jag får hålla full konsentration, vara fokuserad o bara göra jobbet.. o hoppas på att jag är en naturbegåvning, om man nu kan vara d på att klippa hästar?
aja, wish me luck, eller nått sånt så hörs vi senare

//Erika



morgon då

uppe, trött o hungrik next-------> Frukost

//Erika

ETT ÅR IDAG!

Helt sjukt, men idag har jag känt Erika Wenderyd i ett helt år.

Ett år är igentligen inte så mkt, men de känns som att vi har känt varandra i EVIGHETER.


Åh min, fina, fina , fina erika...
Va ska ja säga?

Hon är grymmast, min förebild, min bästa vän, min coach, min ängel, min lilla fikus<3


Hon finns i vått och tort, kallt som varmt, dag som natt.

Kan ALLTID ringa till henne, vare sej jag är glad eller ledsen.

Litar på henne till 10000000%.


Puss på dej honey, du är bäst.




Bilden tog jag för NÄSTAN exakt ett år sedan.





Finns inte många som du, och just därför släpper jag inte taget. <3





//EmmaSahlberg

dagens


ringar, på mitt fina krokiga lillfinger xd

läderarmband'

blus/Skjorta utan ärmar från Vila

svart linne som matchar riktigt bra till nya byxorna (a)

byxor, militärgröna typ, lite ljusare.. o en söt blus

detta va vad jag köpte idag, sååå Erika style! lätt

//Erika

Håll tummarna!

önska mej lycka till i morn, ska tävla i Ulricehamn!

Han har inte hoppat på 2 veckor o detta e en stor gräsbana......mitt mål är att överleva XD

Jaja, hoppas på det bästa, o ja ska satsa ALLT.

2 av mina favvo bilder,








//emma'S

mina överfina <3

kom in från stallet nu, red sista hästen 10.. ja som sagt.., jag kan lätt bli lite seg xd
Carro gick bra, fin o mjuk hela passet= duktig tjej!
Harry va lite stel, men jag galoppjobbade honom en stund o jobbade med att få honom mjuk, så i slutet gick han bra!
Khairo, ja va ska man säga? Sagoponny? Går alltid lika fint(nästan iaf) mjuk o bra i båda sidorna, lagom pigg o framåt,lyhörd o på tygeln.. underbart!
så alla hästarna har skött sej bra idag, mina överfina godingar<3
Eve skrittade Jacky idag, härligt att han är igång nu! ska bli så roligt när dom kmr ut på tävlingsbanorna tillsammans! så grymt fina är dom, måste ta lite bilder o filma o så...!

nu ska jag ta o sätta mej med en kopp te, såklart, framför tvn o bara ta d lugnt, mys
men innan d, kommer min lilla shopping upp här, on the blogg.. såklart!

o glöm inte komentera de här inlägget me..

klickade mej in på denna coola bloggen, helt nystartad.. så inte helt igång me design o så men aja en cool kille iaf! tryck HÄR för att komma till hans blogg!
 nice när d komemr nya killar till bloggvärlden, lätt!

//Erika

galopp o massa firande

Galoppträning gick awsome, förutom d att Drömmis skena lite halft då o då, o att Elin hamnade i ett dike med lera.. men annars gick d grymt bra!
så nu är pållarna inne, jag ska dra ut i stallet o rida en ponny innan Eve kmr, sen rider jag en med henne o efter d så ska jag hoppträna Carro.. min kväll jupp

Va hos farmor förut, grattade henne o firade o så,.. hon fick två (sjukt snygga) halsband o ett gulligt kort, o vi.. vi fick smörgåstårta- yammi
o nu är d såhär va,.. att d är inte bara farmor som ska firas idag.. utan..:
IDAG HAR JAG O MIN FINASTE EMMA KÄNNT VARANDRA I ETT HELT ÅÅÅÅR!<3
så idag firar vi ettårsdag
tycker ändå d är värt ett grattis! för utan den dagen, no www.siiimplythebest.blogg.se..nepp

komentera flitigt, så hörs vi sen.. kram

eran Erika

Vad tycker NI?

Passar jag i denna hjälmen??

behöver some help, så KOMENTERA FLITIGT nu, tack<3

//Erika

bjuder helt klart

Jag kan se ut på många sätt...yepp

de här bilderna tog en paparazzi på mej i skolan...


hahaha asså jag skrattar så galet mycket när jag ser dessa bilderna xD ooo nej, ni ska inte tro att jag brukar sitta såhär på lektionerna, xD men såklart.., jag bjuder på denna!

ooo denna m xD asså, tro inte att jag är en random.. eller föresten? det kanske jag är?
haha hur som helst, klädsen o sminkvalet beror på ett mellanstadiedisco min klass höll i.. o ja, vi behövde två biffiga dörrvakter, så såklart jag o Alice ryckte in! xD

ibland måste man bjuda på sej, så here I am!
x'D

//Erika


suck...*

Jag o mamma är ju så galet långsamma...!
åkte en "snabbis" till Stjernboden, klädaffären i ubbhult centrum,..som faktiskt är en av d bästa affärerna jag varit i, yepp d är sant
hur som helst, skulle bara kika in lite snabbt o kolla.. blev att vi var där EN TIMMA o lite grejer följde med hem, bilde rkomemr sen promise!
o ja, galoppen hos gustafsson blev uppskjuten igen.. men nu! nu går jag faktiskt ut så vi kan sticka, efter jag skrivit klart då
så vi hörs senare, med bilder o lite annat skoj.. eller?

//Erika'¨

uppe med regnet

uppe-yepp
pigg-njaae
Taggad inför dagen- trött o d regnar.. sådäär
att göra idag-Fira farmor,rida 4 hästar,städa(yippie) chilla

regn,regn,regn,... suck
man blir så otaggad till allting när man vaknar o d öser ner regn..men lite vatten stoppar ju inte en ryttare från att rida.. nepp
så nu käkar jag some frukost, sen drar jag ut o fixar iordning Drömmis o Jerry, jag o mammi åker till Gustafsson(yupp idag ska vi d) o galopptränar Drömmis, o elin tar Jarad=det kommer gå fort-mmmh
sen ska jag fixa lite här hemma,städa o så,.. alltid lika roligt..
o så ska jag såklart rida mina andra överfina hästar, o chilla lite..såklart
Eve komemr ikväll o rider Jacky, så jag tar ju en häst me henne,..

hörs senare, min mage skriker efter frukost

//Erika

älskar bilden på min finaste Khairo<3

du är perfekt för mej<3

Kan man annat än att älska denna ponnyn?

med alla hans roliga miner o mulvippningar, han är ju bara för söt!

så gullig<3

hahahaha skrattar varje gång jag ser bilden! Monsterponnyn dream boy försöker äta upp mej! xDxD bjuder på mej

lilla goa ponny, slickar mej i ansiktet som en hund.. hahahah xD

puss<3 min näsa blev lite platt.. i know xd

Dream Boy, du är perfection<3

//Erika

soova- jaa tack!

Sjukligt trött nu..
mina ben värker efter ha gått runt o Borås hela dagen+ridit 4 hästar
ja o Eve red Jerry,Khairo,Harry o Jacky..så va la klara runt halv tio
nu sitter jag här, in my onepiece by Evelina Zetterström Sandén o chillar..ska ta o sätta mej med en kopp te framför tvn nu med my family, mys
o sry för updaten idag, men som ni fattar, jag har lixom haft fullt upp o inte vart nära datorn.. skönt d me ibland
men nu, nu är jag back on track
så vi hörs imorgon..natti

jag nu.. oo ja, d är en rullator ni ser i bakgrunden.. mamma har den för att kuna ta sej fram utan kryckor inne, hon har ju bruten fot vettni

lovely day with ella

Haft en as rolig dag med finaste ella pella!
Badat massa, solat och åkt bååååt!

Haft de grymt helt enkelt.

Nu på kvällen va vi vid havet o fota, en massa...
Hade super kul..
Ella e bäst..

Så nu sitter vi i soffan me resten av min familj, o kollar på teve o käkar Godis.

Så här komer några bilder, ENJOY!





LOVE till denna människan<3




HAHA BJUDER!





Ja som ni ser blev vi liiite blöta....Haha...XD

Bara för att Ella va tvungen o HOPPA i o springa mot mej XD



Ella Olsson Broander, Världens finaste person.


MASSA kärlek till dej. <3




//emma'S

dagens Shopping resultat,

Efter grymme dagen i Borås med sötaste, så blev d såklart lite shopping..(a)
Kände ändå att jag shoppade på rätt bra, o till awsome priser!
rea på gina= ja, d är väl rätt uppenbart
oo här har ni resultatet and some outfits:

*Blus/Skjorta- Gina
*Bustier gul med spets-Gina
*Shorts vita-Gina
*Halsband- Glitter

Samma shorts o bustier
Gult linne med "volang"- Gina

Samma skjorta
*Bustier svart-Gina
o yepp, här ser ni min nya frisyr, lugg vare ja
va tycker ni? Blev det fint med lugg? o vad tycker ni om min shopping o mina outfits?
//Erika

Shopping i borås

As dålig update idag, ja vet..., men va fasen d är sol,jag är glad o är med vänner.. Datan får vänta ibland! Har haft galet roligt i Borås idag,me underbaraste ävälina<3 blev en del shopping, som sååklart kommer ut ikväll, on the blogg,,.. Hörs later on, nu sticker ja o eve till stallet, rider d finaste hästarna, sometimes life is reeeeally good, yeeeah //Erika

Ändrade planer helt klart

Ändrade planen helt klart,... Blev ingen galopp hos Gustafsson, istället red jag drömmis o Carro hemma, den bytte jag om snabbt, åt lite o nu sitter jag i bilen påväg till eve,.. Vi sticker in till Borås en stund o fikar lite, o d blir säkert some shopping oxå, ofc!xd grymt mysig go dag me bästaste, som oxå åker me hem t mej sen o rider sin lilla ponny nät jag rider mina små sötisar sen, kakan o Harry är ju kvar <3 o ja, som ni nog förstår blire inte nån grymme update under dagen, men nått blire, lovar! Hörs senare //Erika

uppe me tuppen-- njaaaeee

jag har gått o blivit riktigt seg asså! vänt på dygnet helt, lägger mej halv två o sen så försover ja mej vaaarjee dag.. suck*
men idag, ska d bli ändring på d xd
hur som helst, nu är ja uppe.. ska sätta mej o käka some frukost, sen lastar vi drömmis o åker till Gustafsson o tränar på deras travbana, så mr vippmule får lite sm kondition

ser ut som att d blir en ganska härlig dag, o då går jag sååklart ut o solar en stund, för lite till färg skulle inte skada ;)

alla hästar ska ridas idag, Drömmis Kakan Harry o Carro eller Conny... btw Kakan va gaalen igår xD
tränade på en linje som låg på typ 40 cm, skulle få in så få galoppsprång som möjligt o så mycket som möjligt!o mr Khairo va huur laddad som helst! så fort jag tog i honom på linjen så lufthoppa han o stack, hmm... så d slutade med att d istället blev en lydnadsträning att göra halt o skritta på den linjen.. yepp
men d avslutade bra, o d är väl huvvesaken?

tror nog att Eve kikar förbi nån gång idag o rider Jacky... o kanske Jerry, vet inte än
yeep, så blir d.. men nu måste ja dra o käka.
see ya
//Erika

ett tips:
Håll i era vänenr o ta aldrig dom förgivet....<3

jag bjuder, helt klart!

Gästbloggning

Hej alla Erika och Emmas bloggläsare!
Nu ska jag göra ett försök på gästbloggning-haha ;D

Jag heter i alla fall Antonia Pettersson Häggström. Jag är 14 år och bor i Kungsbacka (mamma) Och i Hällesåker (pappa)
Båda mina föräldrar har en gård (pappa äger Mölndals RK och har Ranchens Ridläger på somrarna) Och mamma har ett litet stall med fem boxar, paddock och gräsbana :):) Båda mina föräldrar är väldigt hästkunniga (STOR fördel för mig) och har ridit sen dom var små och jag har alltid varit uppvuxen med hästar.
Jag fick min första ponny när jag var 6 år gammal, en liten b ponny som hette Casper. Han var en busig ponny som också var ganska lat, vilket jag tycker är bra i början då man får lära sig att använda benen, inte bara "dra i två snören". Sen när jag hade haft Casper i ungefär 2 år och tävlat lite clearrounder och klubbtävlingar på l.c år så tyckte pappa att jag skulle ha en bättre ponny! Han kollade runt på olika annonser och fastnade för rubriken "SM ponny" Han ringde på annonsen och ponnyn som hette Timone och jag provred honom några dagar senare. Han var en fin och ädel ponny och lite ovan att rida i jämförelse med Casper, men jag tyckte väldigt mycket om honom-så han fick det bli! Det visade sig senare att det kanske inte vart det bästa köpet. Eftersom att jag bara var 8 år så var jag väldigt orutinerad, så varje gång jag hoppade på Timone och han kände att jag satt i obalans, så bockade han av mig-Taskigt va? HAHA x) Han gav mig inte så bra självförtroende efter att ha gett mig några ordentliga luftresor i ridhuset. Jag hade inte Timone i mer än 2, 3 månader. Han såldes sedan till Ida Haglund som då var 11 år och hon hade fina resultat med honom! :):) Nästa köp av ponny blev russet Rusty! Han var en bra taxiponny som stärkte mitt självförtroende! Han hade jag i ca ett halvår och sen fick min syster Axelina ta över honom. Efter Rusty köpte vi faktiskt ett till russ! Dunderrusset Sharmör! (han stavas med S) Han var mycket ädlare än Rusty och hade faktiskt gått Msv b! Han var lite ovan för mig i början, eftersom att han hoppade så mycket med ryggen. Jag kommer ihåg att första dagen jag hoppade på honom så flög jag av 2 gånger! Ingen bra start, haha men bättre blev det ;);) Vi tävlade l.a tillsammans med vinster och placeringar och 2 fnaler i Sveland Cup. Efter att jag haft Sharmör i 2 år så fick Axelina överta honom och jag hade då bara Lords Piccolo (som jag hade haft lite samtidigt dom Sharmör) "Pricken" som han kallades var en fulsöt ponny som jag älskade över något annat! Sven Ingvarsson lämnade Pricken till oss en fredag för att jag skulle ha honom på prov i några veckor.. Jag red och hoppade honom på fredagen och han kändes som handen i handsken helt enkelt! Jag skulle tävla på lördagen på min andra b ponny Sharmör, så vi tänkte, varför inte ta med Pricken också? Det gjorde vi och Jag hoppade l.b och l.a och var dubbelnolla och kom 2a och 3a ! Väldigt bra ponny dedär tänkte vi och Pricken var min! Isabelle Karlsson hade Pricken innan mig och hans bästa resultat var 1a i regional msv b. Vi blev ett väldigt bra team, jag och Pricken! Vi tävlade upp till msv b med mängder av vinster och placeringar! Det bästa minnet med honom var SM:et i Ljungby 2009! Vi var 0a i kval ett, kval 2 och finalen! Sen i omhoppningen så fick jag ett pet på första hindret, så det blev en 9 plats. Men han var sjukt grym och Pricken är nog ponnyn som har legat mig närmast hjärtat! ♥ Han såldes efter SM till en tjej som heter Vilma Larsson.
Sen Harry Potter storyn... Jag köpte Potter som 5 åring år 2007. Han var oriden och svår. Som tur var så hjälpte mamma mig väldigt mycket med honom! Det första året var han pest och pina! Jag tyckte att han var ett litet monster-haha :):) Men efter hand så blev han bättre och bättre! När han var 6 år så kom han 2a i ungponny championatet och 3a i 6 års SM. Jag tävlade honom i tills förra året med vinst i Ridsport Ponny cup och andra msv b klasser! Våran sista tävling var SM i Strömsholm, Jävla skittävling! Jag skulle aldrig åkt dit om jag visste vad som skulle hända! Det var kontrollmätning och det var bara in med ponnyn, på med stickan och ut igen. Efter 2 månader så fick vi ett brev hem: Harry Potter är uttagen till kontrollmätning. Resultatet på det blev 131.9, Snipp snapp snut där var Potters glänsardagar slut.. Asså jag fattar inte! Ponnyn är väl fan inte bättre för att den är 1.9 cm förstor? nej! Låt han vara b ponny! Han är bygd som en b ponny och rör sig som en b ponny! För mig kommer han ALLTID att vara en B ponny! Nu är han bara en i mängden (bortsett från att han är världens välridnaste ponny) Jaja, EN fördel som jag kan komma på är att jag kan tävla honom, haha fast jag är to tall tyvärr.. Men jag tävlade faktiskt msv b på honom (110 cm) och var dubbelnolla! STOLT, han har gått msv a som b ponny x) Sen köpte vi Kenwoods Cymro! Han var en welsh på 6 år som jag hade i 2 år. Vi tävlade msv b och Vann faktiskt "NM i stilhoppning"! Hur kul som helst var det :):) Han var nog den sötaste ponnyn jag någonsin haft! :D:D Jaja nog om detta... Back in real life...
Här är ponnyerna jag har nu:
En C ponny som heter Cleopatra "Cleo" Hon är 8 år och en riktig liten prinsessa! Vi har tävlat msv a och hon har världens finaste språng och en stor kapacitet! Tyvärr har vi inte kunnat tävla så mkt i år pga hennes skada som inte veterinären har kunnat reparerat. Men IDAG så var vi hos en gubbe som såg direkt att hon hade ont i bogen masserade henne med något som typ gav inre massage som hon tyckte var jätteskönt!! Det kommer att göra henne fit for fight again! :D:D
Sen har jag 2 d ponnyer från Irland! Båda är 8 år och dom heter Dunbelieveable "Gul" och Shu B Dee "Bosse"
Jag köpte dom i november förra året på Irland och då hade dom båda gått några msv b. Dom var oridna och mer eller mindre galna-haha :):) Men båda hade viljan och Bosse hade en enorm kapacitet och Gul var väldigt försiktig och hinderklok. Så dom fick det bli! Dom var som sagt väldigt oridna och jobbiga på marken! Jag och mamma kämpade med dom hela vintern och det gav till slut resultat! :D:D Dom har fortfarande mycket kvar att lära, men dom är en bra bit på vägen! I mars tävlade jag dom första gången l.b och l.a. Det gick bra. I början på maj debuterade jag msv b på båda med 4 fel men snabbast tid. Bosse debuterade msv a i juni och vann den! Gul hoppar också msv a med bra resultat :):) Det var lite av en chansning att åka till Irland och köpa 2 gröna d ponnyer med så fick det bli och det gick vägen- som tur var! :D:D Är iaf jätte nöjd med dom!
Nog om detta!

Några saker som jag tycker är viktigt när man rider och tävlar är att man har mål. Varje vinter så skriver jag upp olika mål med varje häst. Ibland uppnås målen, ibland inte, men man måste hela tiden ha någonting att kämpa och sträva emot! Sen något som jag också gör är att jag låter mina ponnyer som har tävlat hela året få en vintervila på vintern som är i ca 2 månader. Dom brukar antingen vila helt, eller gå på skrittbandet. Sen så kollar en veterinär på dom mitt på sommaren och dom brukar ha ett break från tävlingar i ca 4 veckor. :):)

Mina mål med d ponnysarna är att rida EM! Eller det kanske mer är en dröm.. Men det skulle i alla fall vara otroligt kul att få uppleva det!
Min nästa tävling är SM om knappt 2 veckor. Då ska Bosse gå själva SM:et och Gul ska gå något som heter Antarés cup tror jag ;);) Så nu är det hårdträning som gäller med Lennart Linderlöw!

Det var nog allt om mig! Ha de jätte bra! :):)

BTW! Erika är världens roligaste person med en grym humor som jag gillar skarpt! Världens snällaste kompis! ♥

______________________________________________________________________________________________

världens grymmaste finaste chey, Antonia Pettersson Häggström <3 hoppas ni diggade detta, för d gör jag, lätt!

//Erika (tror nog att emma gör d me)

btw, blir lite konstiga kod saker mitt i texten, don't know why

tömkörning

käkade grymme middag me la familj ;)
nån yammi fisk,bacon,färskpotatis,pepparrot o min favvo dryck- mjölk
drog ut i stallet sen, borsta Harry o slängde på tömkörningsgjorden, för omväxlings skull
va la 1 år sen jag tömkörde sist, men d gick rätt bra! harry har ju A-ponny trav, men va fasen.. man travar väl inte runt hoppbanor ändå?
eller? xd jag brukar satsa på att galopepra iaf xD
han är så söt när han tassar runt, gullen<3
fast d är bara i början har mini-steg, när han väl ha rkommit igång, då ni.. då händer d grejjer! xD
aja nu ska jag inte tjata mer om d..

kom in för typ 15 min sen, nu sitter ja o skriver lite me finaste antonia, som är sjukligt saknad
om typ, 5 minuter kommer en grym gästbloggning, så håll ögonen öppna,

kram
Erika

The Antonia

håll utkik, ikväll kommer en exclusiv gästbloggare..
woop woop

//erika

stallet väntar, alltid

nu drar jag ut to the stable.. hörs senare

//Erika

alltid lika glad

tidsmaskin?

ibland önskar jag att man kunde spola tillbaka tiden....

//EW


välkommen in

kom precis in, solat ute i en solstol.. myys
med musik i öronen o en smoothie i handen=Livet
d tråkiga är bara att solen försvann efter typ 10 min, happ.. va gör man då?
låg kvar en stund bara för att d va så härligt, nu blire lite nybakade frallor, varma.., yammii

nåra låtar som följde med mej ut:






sjukligt bra låtar, kan sitta o lyssna på samma låt om o om o om igen hur länge som helst
grr

ska ta o dra ut i stallet kl 17 igen, tre hästar kvar o rida.. men nu.. känner jag för en dusch,. så sjukligt varmt nu ju..o sen lägger jag mej i solen en stund till(den kom tbax nu),.. hörs later on

//Erika

snart

frukost-check
nu sticker ja ut i stallet..
känner lite för att dra till stranden sen, sola o bada..hade vart riktigt nice¨
men har så sjukligt mycket o göra här hemma..suck*
o en del att tänka på.......tyvärr

känner att tiden bara drar iväg... bara några få veckor kvar på sommarlovet
skolan börjar, jag börjar 8.. betyg here i come- yippie
längtar ändå efter alla friends, som jag inte träffat på sjukt länge..
men jag har massa saker som jag vill göra , innan vi börjar..
en lång lista typ xd
så, d är la bara till att börja arbeta av den listan.., eller vad säger ni?

oo om bara en vecka, 7 dagar åker vi till Skövde,Grevagården RF för 2011s utomhus sm
mitt 6 sm, 3dje gången på C-ponny
huh
är galet taggad, Drömmis känns super fräsh.. d visade ju han i förra helgens Msv A.. ja innan han vände vid utgången så att jag trilla av, innan d så va han super!
åker dit på onsdag eftermidda eller torsdag morgon.. beror på när d börjar på torsdagen
med mej har jag alla ponnysarna, Drömmis går sm o d andra två hoppar kringklasserna i LA-Msv B
alla d bästa är på plats, sveriges bästa ekipage o sveriges bästa människor, helt klart
kommer bli sjukligt kul, massa gamla ansikten, en del nya
ååh gud va jag längtar,lätt att jag gör!
taggad till tusen, nu kör vi!

//Erika


pigg o glad- d är jag

uppe..trött..seg..hungrig..erikas bästa morgonhumör..wiihoo

bjuder på denna.. xD

ska sätta mej vid tvn o käka frukost,sen bara chilla lite
går ut i stallet o rider en storis me pappa vid 11..sen?
vet inte så mycket hur dagen ser ut förutom att jag ska rida 4 hästar..
kanske åker bort med mammi till stjernboden sen o kikar lite..hittade lite nice saker igår..hehe ;)

magen skriker.. så hörs sen, när magen är med mej

//Erika


mycket idag asså

sry för dålig update idag.. men ahr haft ett galet full schema.. som höll sådär i slutändan..
dagen slutade njaaaee. inte jätte bra o Carro fick vila pga att vi kom hem från Nickes match nu.. 23.15 ;)
liite sent att gå ut o rida, eller va tycker ni?
matchen gick sådär.. d förlorade men ja tycker Nicke spela bra,. inte för att jag kan så mycket om sånt men liite har jag väl ändå lärt mej under mina år som fotbollsproffs i Ubbhults if xd
haha xD
nu sitter ja här, kollar lite bloggar o kikar runt, finns galet många fina bloggar där ute, lätt
komentera gärna eran bloggadress så lovar,lovar,lovar vi att gå in o komentera o digga.. proomise
nu ska jag ta o hoppa in i duschen, mmh ;)
efter d-säängen
uaah, zzZzZzZZzZz

//Erika


In the car- again

Tråkig mobilblogg, but jag sitter i bilen på väg till brorsans fotbollsmatch-yepp... Hejaheja! Kommer antagligen hem sent, o då ska d ridas, storhästarna är kvar serru... Lär sova gott.. Förhoppningsvis, suck* Hörs lates on, me some fotbolls resultat xd // Erika

solen skiner

himlen är blå, vad de e skönt att leva dåå...

haha hej på er XD

hoppas ni har de bra, för de har jag,.
Sitter just nu på altanen i stuganmed datorn i knäet. För er skull.

Rätt dålig update från min sida, men ja menar, de e sommarlov och solen skiner o man badar.
Då VILL man INTE sitta inne med datan XD

Kan iaf säga att jag o Jolin hade de super igår, sola o bada hela dagen ;)

O idag har vi varit en sväng på lottas lada. Köptte en sak ja kan visa när ja e hemma.

O gissa vad?
I morn kommer min bästa ella olsson broander hit :D
Ska bli as najs!
Saknar henne sååå...<3

Kan ju även berätta att nu är Coopers vila över, han har gått ute dygnet runt förra veckan på sommarbete! Men igår sattes han igång igen, av Lisa, som står i samma stall får rida han denna vecka tills fredag för på lördag ska ja tävla så han får komma igång igen ;) (jag kommer hem på fredag)

Dethär  va ett rätt tråkit inlägg, menmen, har ju inget annat o berätta.






//emma'S

Tar cykeln

Nu tar ja o Eve cykeln till Stjernboden, en grym klädaffär här i min lilla by
yepp det är sant, vi har faktiskt en riktigt bra klädaffär här..
tittar lite, o kanske blire så att någonting hänger med hem? who knows?
sen blir d till att chilla lite i solen,o rida
ändrade planen lite.. ja o eve rider ponnysarna, pappa o ja rider storisarna.. d blir bäst så

//Erika

ni har sett den förut, men jag kan inte få nog av den.. älskling<3

stallet nu då

yepp, drar ut i stallet nu.. hörs later on

//Erika

Riiiiiing

sov grymt gott i gäststugan,.. ända tills den j*kla väckarklockan ringe.. SJU @@@
hade väl glömt att stänga av den förra gången vi sov där ute@

nu blire lite frukost me varma frallor o te, muumsi
sen dar vi nog ut en sväng o rider.. 3 hästar var idag

Pass 1- Erika-Bruno Evelina-Conny
Pass 2- Erika-Harry velina-Drömmis
Pass 3- Erika-Khairo Evelina-Jerry

så får d bli, funkar nog bra..
Ja o Eve har ju börjat träna d andra två storisarna nu, Conny o Bruno, the big horses-yepp
antar att d blir lite små fix o mockning me- o där imellan, chill
rätt nice dag

vad händer hos er då?

/Erika

alla våra stora o deras mammi Gavotte<3


stallet-done

klar me allt i stallet nu... så nu blire middag, 22.34 yepp
sen drar ja ut o hoppar me eve xD lite natthoppningen e alltid bra ;)

hästarna gick bra..
Jarad red jag i skritt o trav, ställde o böjde o jobbade för att få honom mjuk, eve skritta jacky
sen gick jag från B-ponny på 130 cm till storhäst på 174 cm, funka d me
red Conny i skritt o trav, galopperade lite.. han är ju som en 3 åring att rida.. rätt roligt att känna att det är jag som gör jobbet från grunden..
Eve red Carro lite, tog ett skutt på 50.. haha xd

ska nog klämma in en dusch oxå, så godnatt på er
hörs imån
//Erika

älskar bilden, Jennie, söta jennie med super styrkan att lyfta 3 personer xd

Trassel

såg en galet söt film som jag är förälskad i, Trassel
helt underbart gjort asså!
gulliga animeringar,o bara allmänt gó! xd

Titel: Trassel
åldersgräns: 7 år
regissör:Nathan Greno, Byron Howard
Det filmer försöker tala om: Om du har 3896,9876 mil långt hår o är inlåst i ett torn är du antagligen
den försvunna prinsessan
betyg: * * * * *

/Erika

bortkämda snorungar är d allihopa,allihppa,allihopa

är man dålig för att man köper en ponny som har gått stora klasser innan?
isf, när man väl har kämpat upp en häst till d högsta,största,svåraste d får gå.. ska man bara ställa av den sen då för att ingen vill köpa eftersom man är dålig om man köper en "färdig" häst?
njaee, tror inte d

läst en del gamla inlägg,på olika bloggar där vissa blir upprörda o komenterar att man är dålig om man köper en häst som har gjort d innan.
what?
d skriver att man ska kämpa med den hästen man har, o inte sluta..
men, om man har en ponny som ABSOLUT inte VILL hoppa..
o själv vill du utvecklas,komma frammåt,uppåt i klasserna o ta dej till toppen.. ska du fortsätta kämpa med den ponnyn då? är det inte bättre att någon annan får chansen att få denna ponny, o göra d ponnyn vill?
o så köper man en n y ponny som har gjort det innan, som kan lära o hjälpa dej..
en ponny som kan ta dej längre
o bara för att man "får" en bättre ponny, som har gått högre,vill mer så betyder väl inte d att man är en dålig ryttare som inte kämpar?
för det spelar ingen roll hur MYCKET du än KÄMPAR om inte din PONNY vill lika mycket som DU

o bara för att ponnyn gjort det innan betyder inte det att den gör det EXAKT lika bra med dej, utan du får oxå kämpa för att lära dej ponnyn, rida den på rätt sätt o utvecklas..
för barn, o ungdomar behöver en schysst ponny, en ponny som kan LÄRA DEJ.. för det är inte många som kan lära en ponny

o om INGEN köper dessa "fullärda" ponnysar, va ska dom då ta vägen? ska dom bara gå i en hage, eftersom alla ska lära sina hästar från grunden o utveckla dom själva?
o bara för att man får chansen till att rida o tävla en bra ponny som du kan lära dej något med o komma långt me så är man en bortkämd liten snorunge?
meeh?
nej, man är inte en bortkämd liten snorunge..för att man får chansen till detta !? o en sak till som många glömmer:
Man köper INTE framgång
framgång kommer när du sattsar,tränar,försöker,kämpar
 
/Erika

vad tycker NI om detta?


schemat for this eftermiddag

*diska
*fodra
*packa ur lastbilen
*äta
*rida Jerry
*rida Carro lr conny

o såklart lite chill där imellan
är fortfarande sjukligt trött, lätt att jag är..
så ska lägga mej i sängen o bara vila lite nu,äta nått o titta på top model australia
ibland är allt underbart

/Erika

sun

steker i solen, hörs later on

/Erika

sommarfavoriter 2011

gamla bilder, men klart fortfarande favoriter


Cristalls Jarad, den finaste B-ponnyn in da world

Not my pony, men ändå en favorit

Jerry again, love this picture<3

Dream Boy, Msv B vinnst..<3

Drömmis sm 2010,..

Årsta runsten, sm 2010

Dream Boy, markarbete at home

Drishoge Khairo, Björbäck

Skånhällas jackpot, Skoglotten LA

Harnells Tricky Dicky, även känd som Mr Honeymuzzle


nåra av mina fovvosar right now

/Erika

seg morron

vaknade sent, för att vara jag..10.15 nästan nått rekord ju xd
käkade frukost precis, o tittade på slutet av en galet söt film! Stuart Little 2
handlar om en liten mus som kan prata o bor i en familj, som behandlar honom som en vanlig kille
verkligen super gullig! haha

nu ska jag dra ut i stallet o packa upp från tävlingen, för d måste ju oxå göras..wii
sen tänkte ja faktiskt gå ut o gå eller springa, får se
inte ofta ja gör d men just nu bara känner ja för att komma ut lite

ska rida två hästar idag, rätt skönt... Harry,Dröm o Kakan vilar idag.. så ja rider Carro o lite på Jerry.. xD
ska se fall vi kan få hit Eve oxå så att hon kan skritta Jacky, deras bil har ju gått sönder serru

vad gör ni idag?

/Erika

RSS 2.0