Allt-Check

Färdig packat.. finally.
listan är galet lång, men tror nog att allt är avbockat.. eller vi får väl hopaps det i alla fall! ;)
nu blire till att hoppa in i duschen, sen direkt to bed, ska upp vid 5 imorgon tror jag, underbart.
har fixat lite inställda, och så.. emma bloggar+ att jag kanske har en till idé.. men de får ni se imorgon
sov gott, så hörs vi imorgon.
image description
xoxo Erika

Tårarna kom.

läs DETTA.. ALLA ska läsa.. översta inlägget.
LÄS, tänk och gråt.
Jag mår dåligt när jag läser hennes inlägg, jag vill bara åka iväg o sätta mej brevid henne och bara sitta.
jag kan inte förstå hur det är, jag kan inte ta mej in i hennes  situation, men jag kan tänka mej, och jag vet att det hon går/har gått igenom, är något av det VÄRSTA en människa kan uppleva.
Hon är en stark person, som har tatt sej igenom detta, och kämpar.. för det är inte lätt,

När jag lästre igenom detta, asså tårar kom.. det lovar jag.
Jag kan inte förstå hur folk MEDVETET kan sitta framför sina töntiga datorer och trycka ner nån, kränka och SÅRA någon, och som dom dessutom inte känner??
jag säger inte att man ska gilla ALLA, för det går inte. MEN man behöver inte visa det. Man BEHÖVER inte säga alla elaka tankar, man behöver inte snacka bakom allas rygg, men de tär så vi tjejer fungerar.. de flesta av oss iaf.
VARFÖR ska det vara så attans svårt att hålla tillbaka? Hålla käften rent ut sagt..???
Jag kan bli så trött, och BESVIKEN.. ja besviken faktiskt på ALLA som har suttit och kommenterat hennes, och andra bloggar, med elaka taskiga negativa kommentarer, VARFÖR??
vad är det som lockar med att kanske rent av FÖRSTÖRA en annan människas liv?
Är det en hobby? Folk som är avundsjuka, eller inte lyckats med samma saker, som inte nått sina mål eller tatt sej dit dom vill, dom ska sitta o förstöra o såga ANDRA som faktiskt HAR lyckats?
Eller ska man trycka ner dom som redan är svaga? Dom som redan är nere på botten?
Schysst spelat.
så till alla, om NI någongång kommenterat elakt, never ever do it again.. det är INTE okey.


ni vill jag att ALLA ni som läser våran blogg, ska gå in på isabellas blogg, lläsa hennes grymma,fruktansvärda text och lämna en kommentar.. det minsta man kan göra.

xoxo Erika

Mot stallet!

Nu ska jag o mamsi åka till stallet och göra iordning för Cooper och ge pållarna kvällsmat! Hörs senare!!

/Emma


Btw; igår blev Molle bebis 15 veckor!!<3


snabbt schema

schemat for today:
rida drömmis
rida khairo
äta
PACKAPACKAPACKAPACKAPACKA
blogga
duscha sova.

mycke PACKNING idag.. och MASSA massa bloggning!
hörs senare.. måste---> ut i stallet NU

xoxo Erika

svar

Anonym om pics @ my place:
tack för svar ser ut som ett drömställe så fint ! :)
IP: 148.160.250.14
så lite så! oh TACK så mycket!
kram Erika

En bild..

Som påminner mig om sommaren.
Detta var när jag o Lisa skrittade ut barbacka till sjön och badade med hästarna! Fast ja kan verkligen inte fatta hur jag vågade det Asså såhär nu i efterhand, med tanke på hur galen Cooper är xD ja kommer ihåg att han vände o stegra o sprang iväg med mig fleraflera gånger.. Så antingen fick ja gå brevid honom , eller så gick Lisa så hon snabbt kunde fånga tygeln om han vände o sprang iväg xD lite kul ändå^^

Men det var en mysig dag, o Cooper lekte med huvudet i vattnet ! Han älskar verkligen o bada, så de får vi göra snart igen!<3

/emma


Fortfarande sjuk.......(!)

Ush va jobbigt det är! Ni får ursäkta den dåliga bloggningen men jag har inte orkat. Då e de tur att vi har Erika!
Hoppas verkligen att ja e frisk i morn!

Cooper får vila idag så ja blir bra fortare. Jag klippte honom igår oxå! Blev jätte bra! :] klippte hela benen, så han inte e en liten skogsmulle på grevagården ;) Ne nu måste jag vila. Men ja lovar att uppdatera er mera under dagen idag.

/emma


dagens outfit

leopard byxor
swarovski skärp
jeansarmband+litet silver
svart uringad tröja ifrån JC
pälskrage ifrån H&M
xoxo Erika

pics @ my place

Anonym om @@:
vilken stad och vilket stall har ni era hästar i ? :)
IP: 78.73.47.221

Hej!
Asså jag bor inte diretk i en "stad".. haha
utan jag bor i ett litet samhälle mitt emellan borås,göteborg o kungsbacka, och eftersom vi bor på en gård så har jag mina hästar hemma i vårat stall :)
xoxo Erika

@@

haft problema med de interneto, så därför ingen bloggning föräns nu..
men HEJ!
Red Dröm i ridhuset idag, innan alla träningar började.. hacket åkte på idag, funka ganska bra, han va VÄLDIGT mesig bara, haha men annars gick det bra..
Sen gick jag in, och STEKTE PANNKAKAOR, stolt*
Jag ör värdelös på att steka pannkakor.. ibland- och idag va en sån dag xd blev lite sådär halv bra, trasiga,knapriga.. men de funkade ändå, haha
eve kom vid 19.20, red Harry o hoppa lite.. jag red carro samtidigt.
Eve o Harry hopapde super idag! känns ätte roligt o jag tror det blir super bra! VArför red eve harry kanske ni undrar? Jo, jacky är inte riktigt igång för att gå en sådan stor tävling som Grevagården, så därför erbjöd jag idag henne att hoppa harry tors-fre o ha han hela helgen, men jag tävlar lör-sön.. blir toppen så!
efter carro blev de Khairo, BUS pigg ponny idag, o pretty strong! men det gick bra, han är fräsh o VI är galet taggade inför baltic+ debut i msv B+5.. yeeee
har även packat lite outfits inför helgen oxå, fick ihop nåra riktigt grymma.. gött
vad gör ni i helgen??


xoxo Erika

*Stallet*---> NEXT

okey.. nu drar jag ut för en hel eftermiddag i stallet..
ska rida Dröm,kakan o Carro, vanligt markarbete only, nothing special
sen blri det tilla tt börja packa inför Baltic, och plugga.. wiihoo

hörs later när jag komemr in,.. bye!
image description
xoxo Erika

LÄTT??

vem har sagt att det är lätt?
Vem har sagt att det är lätt att vara en 14, snart 15 årig tjej?
Vem har sagt att det är lätt att rida 3-4 hästar VARJE dag?
Vem har sagt att det är lätt att driva en blogg?
Vem har sagt att det är lätt att gå i 8:an o få betyg.. kombinerat med allt annat?
vem har sagt att det är lätt att hinna med allt?
Vem har sagt att det är lätt att ha STORA mål och drömmar?
Vem har sagt att det är lätt att ha så mycket ansvar?
Vem har sagt att det är lätt att vara annorlunda?
Vem har sagt attd et är lätt att få till det med sina vänner?
Vem har sagt att det är lätt att heta Erika Cecilia Wenderyd?'


-Inte vare jag i alla fall.

xoxo Erika

allt nytt...

dagesn outfit. Nya byxorna- LOVE till dom! underbara, så min stil! Kommer ifrån Gina Tricot
min underbara pälskrage, älskar den! Super musig, och SUPEr snygg! ger ett lyxigt intryck med päls tycker jag faktiskt! xd kommer ifrån H&M 149:-
Köpte nya sjukt gosiga vantar igår me.. super mysiga med pälsludd på kanten och fleece fodrade! komemr ifrån kappahl och kostar 99:-
xoxo Erika

yepp kör en dagens..

Dagens:
Frukost-flingor med mjölk.. mmmm
kläder- Svarta nya byxorna(YAMMI),jacka i skinnimitation med sömdetaljer och BIG pälskrage(nya,..love) svart tröja med galet snyggt tryck
smycken- litet halsband(enkelt med en liten sten på) Två ringara en guld och en silver, brunt flätat läderarmaband och ett swarovski armband, små silvriga swarivski stenar som örhänge
Planering- Skola, rida ALLA 4 idag, plugga, börja packa inför torsdag o Baltic cup
xoxo Erika

Dagen.. den låånga dagen!

PUH*
Äntligen inne efter en GALET lång dag, med GALET mycke att göra!
Gick i skolan, skämde ut mej o hade allmänt sjukt kul och ångest över att gå i mjukisar, haha..inget fel att gå me mjukisar, absolut inte.. men de är INTE min grej!
Sen kom jag hem vid 4, åt lite och tog de lugnt, bytte till svarta jeans o sedan drog ja och mamma till kungsbacka-kungsmässan. Kika efter skor, men jag hittar verkligen inte dom jag söker.. GAAH@@
Stack in snabbt på Lindex, köpte underkläder..  BEHÖVDES!
sedan in på Gina Tricot, love that store! Hittad eett par AWSOME jeans/byxor som liknar skinn men ändå inte.. lixom lite glansit tyg men ja.. ni får se imån,.. AS snygga! Dragkedjor i guld på båda sidor som fickor och längst ner på benet.. SÅ SJUKT SNYGGA! Lätt snygagste byxerna i min garderob... L Ä T T, och dom ersatte helt klart mina skinnbyxor som sprack idag(ooops) till o med, mycke snyggare! Tummen upp för de! köpte även en pälskrage på H&M att ha utanpå en jacka.. blev SJUKT snyggt tillsammans med en grym jacka,och nya byxorna!
sen då när ja kom hem bytte jag om o gick ut i stallet, red carro först..
HOPPA stog på schemat för ALLA idag,.. Gick grymt bra!
Hopapde alla julhinder, hon tyckte de va lite läskigt i början, de första 3 sprången men sen vande hon sej.
Hoppade tillslut några språng på 1.20-1.30 och hon bara FLÖG över hur lätt som helst.. och hur fort som helst. HAHA nä, men PIGG va hon idag!
Sen hoppade jag drömmis lite, bara några språng för att det är kul!
hoppade alla julgrejer, de mesta på 1 m bara för att skutta lite, o sen tog jag ett räcke på 1.10, i full fräs1 xd eftersom snuttis blev rädd för ikeapåsen i hörnet.. MES
Och sen så säger pappa:- Ta den---> o pekar på en oxer, som ligger på 1.20(msv A) ja bah- aha, okej..
och så bara ride rvi på, ohan tar tag o bara suger sej imot hindret och hoppar ett G R Y M T språng! högt över o bara flög! Så underbart att känna att han är i T O P form!
Avslutade denna goa dag med att ta ut Khairo 22.15 ;)
Hopade bara lite på alla hinder, några oxrar på 1.20 och ett räcke på 1.30.. Och jag ska säga, han tar inte äns i! Han bara stampar till o så är han över, ingen big deal! SÅ SJUKT grym häst jag har va.. LOVELY!
så nu.. är jag finally inne, och té+dusch står på listan... gó natt så hörs vi imån!
xoxo Erika

HÖJDEN av pinsamhet

Idag är dagen med STORT D!
IDAG har gjort en av dom PINSAMASTE sakerna jag någonsin gjort.
Jag hade på mej mina ÄLSKADE skinnbyxor ifrån nelly.com,love till dom..
Ja i alla fall, jag o becca stog vid ena änden av våran stora skola(inhomhus) och så skulle ja visa hur vig jag va, haha
så jag sträckte upp benet i luften, och kom as långt upp.! SÅ ja bah: Vänta ja gör de igen, titta här:
Och så gör jag likadant igen, och vet ni vad som händer??
JO MINA BYXOR....SPRICKER , inte i sömmen utan lixom mitt på, skinent bara delar sej o spricker, och bakom kommer några i 9:an... DET, kallar jag pinsamt!
och som tur va så tror jag inte nån han reagera, hahaha.. och så hade jag turen att vi stog utanför en toalett, så jag fick snabbt FLY in på toan o låsa.. och där satt jag o becca o DOG av skratt!!
sen fick vi gå lååångsamt tillbaka genom hela skolan och becca fick gå bakom mej o täcka med jackan xD
Sen fick jag resten utav dagen(detta hände vid 11) gå i MJUKISBYXOR! Eftersom vi ahde idrott så ahd eja me mej mjukisar... och det är SÅ inte MIN STIL! Ush.. inte mjukisar för mej!

DETTA va höjden av PINSAMHET!



Har NI någonsin avrt med om nått LIKNANDE eller något galet PINSAMT??
please kommentera, så jag slipper känna mej så ensam.. HAHA

xoxo Erika

Hej o hå.

Hemma från skolan idag.
Hade en mindre trevlig natt med spyor. hhaha.

Orkar inte skriva mkt nu, så jag återkommer senare.







/emma

Dagens visdomsord.

"You don't know what u got before u missing it a lot"

xoxo Erika

huvud... nej ja menar stenklump

Okey, vädret... BRR
Det blåser sjukt mycke här kan jag säga... kunde knappt rida igår!
Okej, vi har ridhus kanske ni tänker- MEN det blåste så sjukt mycke o tog tag i tak o alla "plastfönster" så att det lät galet mycke. Slamrade o allt bara vibrerade och knakade osv.. LÄSKIGT
Men alla hästarna fick röra på sej, på ett eller annat sätt.
New morning nu då, jag är fixad o klar för skolan.. SJUKT otaggad, ush
känns som att huvudet väger 5 ton när jag ska gå upp på morgonen, måste slääääpa mej ur sängen..jäsp
men ja lyckades komma upp, yeey haha.. hade hellre stannat i sängen ;)
today är jag i skolan till 15.30, sen kommer mamma o hämtar mej så åker vi till Kungsbacka, titta på new shoes och kläder :D Komemr väl hem senast 6, antagligen tidigare..
rider alla 4 idag, hopapr carro+khairo, kanske nån mer.. I don't know
07.49.. bussen går snart.. hörs sen!
image descriptionimage description
xoxo Erika

Den grymmaste omhoppningen jag sett..- LÄTT

Helt förälskad i denna omhoppningen! Så sjukt grymt... Kämparglöd,grym ryttare OCh en grym häst, och det underbarste är de TOTAL coola vägarna! You go girl!
xoxo Erika

VÄDRET.

Detta är inte okej!
Att det ska vara storm och ös regn när det borde vara snö! :(
Paraplyet gick sönder när ja va ute med Molle tidigare idag........

Självklart red jag i manegen idag. Men ush på att gå den lilla biten dit bara!
Red på hackamoret idag oxå, För han vart gansak hård i munnen de senaste dagarna, så då får han vila den lite. Har gjort detta innan och det blev riktigt bra efteråt!
Skritten gick bra idag, (har inga höga krav när ja rider på hackamoret förutom att han inte ska sticka iväg) Traven sådär, o galoppen bra. Va riktigt mysig i galoppen faktiskt :]


image description


/emma


7 good things.. yeah

7 saker jag ser fram imot:
Baltic Cup
GREVAGÅRDEN CHRISTMAS SHOW
Debut msv A med Khairo
Bellas födelsedags fest i januari
Göteborg horse show
JULAFTON
Min födelsedag.. sweet

och ALLT inom 3 månader... Livet är rätt bra ändå

xoxo Erika


Vädret=#%*$£@&€

Hej...
Tänkte ja skulle börja med att Säga varför bloggen har vart så down idag..
Jag har vart i Lerum hela förmiddagen med Evelina och Jacky..hoppat CR.
Tog väldigt mycke längre tid än va vi hade tänkt,så kom hem vid 12.45,fixade lunch till mej,eve,Lotta o mamma--->sen ut i stallet o jobba,vilket vi fortfarande gör. Eftersom vädret är @&€%#$£¥ så kan vi inte släppa ut några hästar,eler embla o Jerry fick gå ut,alla andra ska ridas eller släppas i ridhuset... Så nu sitter jag o eve i ridhuset o tittat på Elvis Wenderyd o Cornelis som busar runt i hoppar,bockar o stegrar omkring;)
Sen blir de:
•rida dröm
•rida kakan/lösgalopp
•hoppa Carro
•hoppa/rida markarbete på Harry
•sy..HAHA

Så jag har en del o göra idag..kommer ofc bloggning...Promise!

Xoxo Erika


Bilder!

Från hoppträningen i torsdags för Anna Emanuelsson! :]

Dålig kvalité, men de e taget med iphoniiiie!


/emma


Jag har bestämt mig...

För en sjutusans massa saker!

1. Jag o Cooper ska tävla utomlands nästa år.

2. Jag ska INTE vara rädd när jag debuterar MSV B.

3. Jag ska ha det galet snygga sverige pannbandet! (som erika la upp bild på)

4. Jag ska rida så bra ja någonsin kan i Grevagården!

5. Jag ska försöka göra så bra ja kan ifrån mig på nästa matte prov!

6. JAG SKA HITTA MIN EGNA EDWARD CULLEN <3


hahah, ibalnd e som jag är XD








/emma



on my list.. hohohoHO

yepp som ja sa... SNART jul.... Och därför har man ju SÅKLART börjat fundera på
presenter, till andra o vad man önskar sej själv,.. :D
Brukar ha ganska lätt för att tänka ut bra presenter tilla ndra, men iår känns det
svårt! har kommit på typ 3 st av 20 ;) Men det kommer väl får jag hoppas, haha
min önskelista är alltid lång, ganska lätt att komma på saker som man vill ha
eller va säger ni?
on my list står:
Ipad...
animo vita ridbyxor
KORT skinnjacka
kläder ifrån Gina
väska..
Mössa med pälsboll(oäkta som SER äkta ut)
assessoarer
schabrak.. de från hööks+J van D
swarovskipannband med FLAGGA

fortsättning följer...


haha listan är lång, men det är som sagt gansla lätt att komma på saker man SJÄLV vill ha ;)
fast hade det varit möjligt.. så hade dessa tre saker stått överst på min lista:
bort med ALLA sjukdomar
Världsfred
Bort med all svält och orättvisa i världen.

tyvärr så går ju inte detta...

best wishes(haha)
Erika

snart jul osv...

Snsrt jul då..
OH MY va allt går fort nu asså, dagarna bara rusar fram, tiden går i 10982 km/h, allt bara rullar på.
Jag har massor på G, massa grejer att fixa och en del uppgifter,.. hehe
Imån är det första advent, känns wierd,crazy och lite skumt.. ja menar- första advent, ADVENT.. UTAN snö, utan is,utan VINTER :o det känns konstigt, riktigt konstigt!
om 4 veckor blire JULAFTON, wiho.. älskar jul, mysigaste tiden på året- LÄTT
det är mörkt ute och man tänder ljus,har en gran som luktar yammi,alla paket(såklart),det är snö ute,kallt--> Alla myskläder åker på... familjen o vänenr är tillsammans o man håller sej inne allihopa.. ja det är MYS
fast jobbigt också, ja menar WIHO hemma från skolan 16.00, ut i staller ida 4 hästar -14 grader.. YEEY haha
men jag gillar't.
Men innan julen är det två tävlingar kvar, två meeting..
åker redan på torsdag vid 7 på morgonen till varberg, tar färjan på 3 timmar över till Danmark (Baltic cup) med Khairo, Carro o pappi.. mamma stannar hemma och tar hand om alla hästar.
Khairo går En blandning mellan stora o lilla rundan.. hoppar Msv B Kval I stora rundan dag 1, sen om de gick bra så hoppar vi kval II stora rundan Msv B+5(!!!) debut, 1.25.. brr
och sen avslutar vi med LA.
Carro går hela lilla rundan, 1.20,1.25,1.20 .. Perfekt
komemr hem på söndag, går skola måndag,tisdag,onsdag--> direkt hem ifrån skolan onsdag o sen sticker vi till grevagården christmas show, VÅRAN egna tävling, som vi+familjen svensson håller i.
MASSA hästar hänger med dit:
Jag Har Khairo,Carro;drömmis och harry med mej...
Eve tar med sej jacky och Elin jarad, så 6 av våra hästar åker med, haha
jag hoppar ALLA höjder ;) LB-msv A komemr jag rida, 3-4 klasser/häst.
ÅRETS GRYMMASTE MEETING! Höjdpunkten på året...
visst de är kallt o allt MEN, bra banor,FINA hinder,GRYMT underlag,alla hästar me, GRYM ryttarfest+julbord, GRYMMA människor.. ja allt är TOPTOPTOPTOP! Längat till 1000
när vi sedan komemr hem från greva komemr hästarna att skrittas på måndag, sen blir det TOTAL vila för dom ända tills juldagen, då ska dom börja skritta o ridas ut i en vecka...
ska faktiskt bli ganska skönt att bara ha tid att ta det lugnt, varva ner, inte stressa när man komemr hem från skolan, kunna vara med friends.. fast det känns konstigt att inte rida... men jag komemr såklart pyssla med dom ändå! Känenr att det är riktigt bra för hästarna att bara ha två veckor(elelr tre) att bara varva ner med, smälta allt som hänt, ta in året o bara vara hästar.. FRIA glada vilda hästar.. MYS för dom med!
så såhär ser planen ut för mej nu, o mina hästar..
Hur brukar ni göra?? Får era hästar vintervila, och hur länge i så fall? Om inte, hur gör ni?




xoxo Erika

Cooper idag!

Blev barbacka idag! Super mysigt<3

Mamma hade även hämtat mitt nya pannband! Ett från John whitaker :]

Ni ser det på bilderna.

/emma


Fråga till er...

hahahhahaha okey, lite fail film, men aja.. please answere the question
xoxo Erika

proud*

Hemma ifrån Konfan nu.. bowlade med allihopa som går onfa vinter, o gissa vad??
jag vann
Hahah, och jag som är uuurdålig på bowling xd faktiskt liite stolt!
nu har jag käkat lite,fixat en liiiten videoblogg, som är on it's way up, o nu ska jag gå ut o rida 2 hästar innan eve kmr kl.18.00.... sen rida en till o efter de---> MYS kväll!
fortsättning på speciella minnesvärda tävlingar kommer sen+ ett till videoinlägg.. who know's?
saknar den här tjejen.
.
.
.
v
xoxo Erika

Hello alla söta!

Blir inget jätte tufft pass för coopers del idag. Bara lite mysigt o gossa med honom<3

Ganska sjukt, de e snart jul!
Känns verkligen inte så...vi har julstakar o stjärnorlampor uppe oså, men de regnar ju?! Ne ja hade hellre haft snö nu...

Vi hörs om en stund!


/emma


Vemkan stoppa mej när ja bara rullar fram....??

Okey, allt brara rullar nu och jag har inte tid för nått känns de som!
gaaah här har ni dagen:
upp 08.30
frukost
konfa-bowling + tacobufé
hemma 15.00
rida
rida
rida
rida
puuuH* CHILLA

vi får höras när ja kommer hem!

xoxo Erika


Galet najs!

Kom precis  hem från BREAKING DAWN med mina 2 bästa , Lisa o Emelie!
Grymt galet sjukt mega bra va den!

Tack för kvällen tjejor<3

Träningen igår gick hur bra som helst! Som ni nog har förstått själva så har Cooper var knasigt pigg hela veckan..
Så ja trodde ju såklart det värsta, att han bara skulle dra o ja inte skulle ha ngn kontroll what so ever!
Men icke sa nicke, min lilla super ponny går som klockan o han lyssnar på mig helt super bra.

Vi började med lite egen uppvärmning jobbade på volter o lite broms o gas. (även om gasen alltid funkar XD)
Sen jobbadde vi på små volter över bockar. Att ponnysarna skulle vara böjda i luften oså.
Efter det började vi travhoppa oxer med 2 bommar framför. Slutade när den låg på 110 cm. Han va super fin!
Sedan gick vi  över till en långsida där det var räcke-kryss-kryss-räcke.
Räcke-ett galoppstrång-kyss-studs-kryss-ett galoppsprång-räcke.
Gick som rinnande vatten där oxå!
Efter det gick vi över till 4-kombination :) Det var:
Räcke-2 galoppsprång-Oxer-ett galoppsprång-oxer-2 galoppsprång-Räcke.
Här va de lite långt i början så till och med jag fickdriva på lite ^^
Sen när anna breddade så brädadde hon oxrarna IN MOT varandra. vilket gjorde att man fick långt 2 galoppsprång o sedan väldigt kort på 1, o sedan lite lagom på 2, kanske till och med lite kort fick några.
Hästarna fick verkligen jobba där o det SYNTES när man kollade på dom andra.
Efter allt detta blev det en bana.
Cooper har ALDRIG haft så jämnt tempo o lyssnat så otroligt bra på mig!
Så jag e ju såklart super nöjd :D

Detta var min sista Anna träning för detta året, då sista är , är jag ju i Grevagården och tävlar ;)

Men de känns bra att avsluta med en Ö.V.E.R.G.R.Y.M.M träning :]

Kanske dags att lägga sig och nana nu, smsar för fullt med lisa, så ja får hålla mig vaken en stund till<3













love,

em.









Två outfits....

Jeans jacka,overknee socks,jeans från frankrike med strass,gulligt mörblått linne
T-shirt med tryck,svart halsduk,vit gullig stickad kofta,vita korta jeans med bruna fickor,höga knästrumpor,swarovski skärp,mössa
va tycks??
xoxo Erika

Ny plan*

ändrade planer, dagen blir såhär idag istället:
Skola -check
mat-lasgne..
rida Khairo
Rida Drömmis
Rida Harry
Back to sätila---> Disco, haha

haha sjukt längesen man va på disco.. faktiskt va senaste riktiga discot i 6:an ;)
Men det blir nog kul tror jag, hoppas det kommer ganska många, har ju iaf becka,markus,bella :)

kommer väl hem vid 23-23.30, mend et kommer mer innan de, promise!

xoxo Erika

vem försov sej???

Försov mej.
SÅKLART! Så nu ärdet SNABB frukost som gäller---> Sen skola...
Today it's friday, så underbart! men veckorna går SJUKT fort nu, helt galet!
This is dagens dag:
Skola till 15.00 hemma 15.30
chilla lite o vila.. mmmmh
rida 3 eller 4 horses idag, får se
IDOL o myskäll me la familia!

go dag.. hörs later on!
xoxo Erika


Nya lover märket

Snart kommer det in ett nytt märke tills Sverige, fager.
Älskar deras designer! GRYMT snygga saker, väldigt speciella och faktiskt, inte särskilt dyra!

ÄLSKAR detta pannbandet, gaah! Så SJUKT fint,utstickande och väldigt speciellt! Lätt på min jullista!!
priset kommer att ligga på ca 400-500:- tror jag, och ett helt vanligt swarovski kostar 700-1.300:- :o

Och detta tränset.. YAMMI!
strass på pannband+nosgrimma.. vet inte om det är äkta swarovski men galet snyggt är de!! Priset komemr att ligga på ca 800-950:-, och det är ju faktiskt inte galet om man tänker på ett fint träns? LISTAN-Check

xoxo Erika

Perfection<3




/emma


Mot hoppträning!

Sitter nu i bilen på väg till hoppträning!


top for moi

Detta behövs för att Erika ska må som ALLRA bäst, top of the hill,körsbäret på glassen.. ja i TOP:
Familj-check
GRYMMA vänner- check
grymma läsare-check
grym skola-check
AMAZING hästar-checkcheckcheck
Framtidsdrömmar-check
Nått att kämpa mot-check
glädje- check...
boyfriend-  
musik-check
image description
xoxo Erika

I will fight for you.... *

I will fight for this.. FIGHT FIGHT FIGHT for this love.

xoxo Erika

we found love....

xoxo Erika

på väg to school!--->

gör som emma.. här har ni 3 sanningar!

Jag kan ABSOLUT inte skada djur! Skulle aldrig få för mej att med flit döda en fluga,mygga,spindel osv


jag, till skillnad från Emma, ÄLSKAR ost och svamp ;)

Jag drömmer OFTA mardrömmar...och det finns EN Dröm jag drömmer 1-2 ggr/år, och det har jag gjort nu i 3 år tror jag xd Den handlar om att jag är vän med en grävling och är och hälsar på honom i hans underjordiska hus, väldigt mysigt hus faktiskt! ;) Och varje gång så går jag ut genom samma dörr, ner för samma branta backe,väcker samma otroligt LÄSKIGA människoätande björns som ALLTID jagar mej upp för backen o precis innan han får tag på mej, vaknar jag ;) och eftersom det är en dröm så går de inte att springa fort.. kan drömmen utantill, även när jag drömmer så vet jag vad som kommer hända! xD

image description
xoxo Erika



Broder Niklas,....haha

Har inte blandat in min familj särkilt mycket här faktiskt.. men här har ni min grymma bror--->
xoxo Erika

thanks!

Sara- Hamreryttarna om Bigbig day yesterday:
.. i detta inlägg: http://hamreryttarna.blogg.se/2011/november/lamna-tillbaka.html :D
IP: 89.160.76.162
23 November, 21:11
Sara- Hamreryttarna om Bigbig day yesterday:
Haha jag länkade dig :D
IP: 89.160.76.162
Haha tack! :D Och eftersom de är så som de funkar on our blog, så tycker jag ni ska checka---> THIS
kram Erika

5 saker ni kanske inte visste...

Kör på en lite rolig grej nu då!


1. Jag äter ALDRIG svamp eller ost. Det är något av det absolut värsta jag vet!

2. Jag är SJUKT morgonpigg. Har aldrig några problem med att gå upp på morgonen, går jätte gärna upp innan klockan 9. Om inte, får jag typ panik o ångest haha.

3. Jag har en fobi....för fötter! Fötter är det äckligaste ja vet..haha ja e lite knasig ibland.

4. Jag drömmer nästan aldrig mardrömmar, men den jag kommer ihåg met är från när jag var liten.
Den handlade om att jag låg fast spänd på ett bord och det fanns massor av onda djur som va typ 2 meter stora, och skulle äta upp mig. Det var älgar, kaniner, vargar och björnar. Kaninerna hade jätte stora kött ätande tänder!

5. Jág har jätte svårt att rida när det finns spån i svansen på hästen. Jag fixar verkligen inte det.
Svansen måste vara genomborstad!






Jaa haha en PYTTE LITEN del av hur knasig jag e... ;)







/emma


svar

Tid 
Matilda om Sky is the limit.. eller kanske vi siktar på grantopparna??:
Har du olika sadlar till alla dia hästar ? :)
IP: 78.72.47.24
Hej Matilda!
Ja, eller jag har tre sadalar och 4 hästar :) Jag har en Prestige gold star svart på Drömmis, En En brun prestige versa... någonting på Khairo och harry(dom delar)och en svart prestige Paris på Carolyn :D Så 3 prestige sadlar hänger i sadelkammaren+ mammas o pappas bruna prestige paris ;)

kram Erika

utvärdering av året.

okej... då var det bara 1,5 månad kvar på detta året.
Det har gått sjukt fort, verkligen SJUKT fort... känns som att det nyss var januari.
fast när man tänker tillbaka på allt vi gjort, så känns det som att det har gått evigheter..haha
jag tänker tillbaka på alla tävlingar, o väljer ut några.. speciella.
Drammen Norge
åkte till drammen i TVÅ veckor, tävlade två helger i rad och där imellan red jag och arbetade hästarna på plats.
första tävlingen med Khairo, LA+5 debut med Harry.. Vad jag minns så var det ganska blandade resultat, haha. Fick med mej placeringar, i massor! Nollade både DEBUTEN och andra LA+5 med harry och var placerad i båda! nollade 2 LAer med Khairo, placerade mej i en... Placerade mej i Msv B med Drömmis, nollade LA och msv B, hoppade Msv B+5 med 4 fel! MEN, jag trillade oxå av 8 gånger på dessa 2 veckor, hahahah xd lika många gånger utanför banan som på, skicklig som jag är!

Baltic cup Villhemsborg
åkte till Baltic med Drömmis och Harry. Hoppade Lilla rundan med Harry, nollade kval 1 och kom 6:a(ska försöka fixa film) och hoppade kval två LA+5, kommer ihåg att det gick sådär.. inte dåligt men inte bra. avslutade sedan med en grym runda i LA, A:0, men rev sista hindret..:/
Drömmis va klockren i förska kvalet, men det var under den perioden då jag trillade av all the time typ,haha. Så i omhoppningen blev det en avsittning xd Kval II msv B+5 hoppade vi oxå en GRYM runda, men fick 8 fel. Och sedan avslutade vi med en placering i LA. Grym helg ocg grymma vänner.. sjukt kul helt enkelt!

SM Grevagården
tar inte tävlingarna i ordning, så grevagården blir nästa!
Hade en grym helg, men också mycket stolpe ut!
Drömmis och jag kom 4:a i kval I, Msv B stilhoppning. fjärde bästa stilen av alla C-ponnyryttare den dagen i Sverige, GRYM känsla! Kval två gick mindre bra pga av att jag blev stressad och att hindren istället för att vara 1.20 var 1.25-1.30 @@ HELT SJUKT! Men what ever,..
Harry gick en grym tävling, placerade oss i LA, nollade LA,hoppadde derby och allt gick super! Kakan gick grymt men vi hade otur, i alla starter utom EN där vi var placerade! Annars 4 fel i alla Msv B:er, sista hindret,avtrampad sko m.m
Hade SJUKT roligt med alla vänner, och det var en LYCKAD helg!


kommer en del II senare!

xoxo Erika

dagens visdomsord.

What doesn't kill you make you stronger.
-ja det har vi märkt.
xoxo Erika

Lite bloggning såhär på morgonen!

Står nu på busstorget o väntar på käraste Lisa. Lite kallt måste ja säga..
Idag blir det ett mark pass för lilla coopisens del. Haha hoppas han e lite lugnare idag så ja kan jobba igenom han ordentligt inför morgondagens hoppteäning för anna Emanuelsson.

Hörs .

/emma


lite snabbt om dagen

ny dag,nya möjligheter... eller ja, det återstår ju att se, men man kan ju hoppas ;)
idag blir det SKOLAN såklart..wiie!
sen hem vid halv fyra, hoppar av bussen häe utanför 4, sen ut i stallet vid 5 halv 6 o rida 3 idag.
Khairo ska hoppa, i GRUPP.. haha det lär bli spännande! xd Carro rider pappa, drömmis går vanligt markarbete och harry går nog rätt lätt idag, för ni har han hård obbat 2 dagar.
sitter och tänker som en galning nu också, på min jullista xd
och vad jag ska köpa till alla? Gaah det är ju så svårt att komma på bra saker, haha
men några grejer vet jag i alla fall... woop
hörs sen, nu blire frukost (a)
xoxo Erika

Sky is the limit.. eller kanske vi siktar på grantopparna??

helt galet.. vi är påväg upp!
 happyface*

idag har hästarna gått like this:
Carolyn: Markarbete i ridhuset, och hon var galet fin! Helt sjukt... red på hacket idag, inte gjort det på flera månader.. men hon var grym på de! Så kommer att fortsätta rida med det hemma, i markarbetet. Hon gick i en jämn stadig form hela passet igenom-good girl!

Dream boy: Hoppade i en av mammas grupper kl.19. Han va en PIGG pålle idag kan jag säga, wiho! Jätte taggad och lydig, till mesta dels i alla fall ;) Han var jämn och hoppade jätte bra på alla knepiga och svåra kontrollövningar som det var idag!

Harnells Tricky Dicky: Hoppade i gruppen kl.20, han va PIGG... lite väl stark men annars var det bra! Hoppade bra,lyssnade ganska bra i alla övningar och så.. så han var också duktigt idag!

Drishoge Khairo: Lösgalopp en liten stund i ridhuset, för imorgon ska han hoppa.. och vi har kommit på att om man lösgalopperar han dagen innan så är han mycket lugnare när man hoppar ;)

Nu ska jag ta o plugga some english.. nej skoja bara.. ändra mej just
NU ska jag duscha, sen hoppa i säng och maybe pluggar jag lite då, innan jag sussar.


godaste kakan i världen<3

xoxo Erika

lite tankar om bloggen osv

www.siiimplythebest.blogg.se. Startades för nästan ett år sedan nu...
i början, ja då la jag inte ner särskilt mycke tid på bloggen, inga jätte intressanta inlägg och kunde blogga var annan var tredje dag.. bra update eller hur?
Men nu det senaste, eller under hela sommaren, så har jag verkligen lagt ner massor av min tid på att göra många inlägg.. o försöka komma på tänkvärda intressanta inlägg, som blandas med lite små korta och vardags inlägg. Jag ska förska bli mycket bättre på videobloggar och filmer, men min dator vill inte alltid. Jag ska ladda in massor av häst bilder, sjukt längesen! Och jag ska skriva LÅNGA INTRESSANTA inlägg... bara för er.

jag vill att den här bloggen ska vara läsvärd, ska vara intressant, ska vara rolig och inbjudande, peppande och frammåt.. men den ska också innehålla djupa inlägg.. inlägg där jag öppnar mej och säger saker som finns i måna tankar. Det ska finnas massor av filmer, videobloggar,musik tips. Och jag ska skriva, ÄNNNU mer än innan, ännu bättre och allt.. ska vara TOP!
för jag vill verkligen att den här bloggen ska vara en insperationskälla för många, ett pepp, och man ska känna att man bara viiill klicka in på www.siiimplythebest.blogg.se.

jag ska verkligen försöka med detta nu. från och med NU kommer det vara mycket mer av allt. En blogg med extra allt helt enkelt, en grraaaandiooosa!
så va säger ni? låter detta bra... hänger ni kvar med oss? Utvecklar bloggen MED oss??
för isåfall... Leeet's go!

xoxo Erika

???

Har en fråga till ER som läser detta...
Är lite sugen på att byta header+design.. skulle gärna ha en lite mer "höst/viner design" med lite mörkare färger såsom brun,marinblå.. eller höstig med rött,brunt,gult ja ni fattar.. men frågan är då.. KAN NÅGON AV ER GÖRA HEADER+DESIGN?? En photoshop eller annat bra program? Isåfall får ni super gärna höra av er till oss, antingen kommentera eller meila berggren.wenderyd@telia.com

xoxo Erika

Hej alla glada o goda.

eller e det glaá o goá?? (haha)

Dagen idag har vart jobbig men rolig, upp tidigt för att duscha o sen till skolan.
Skolan gick ändå rätt fort idag, skönt det ;)

Efter det va det åka hem direkt o käka, gå ut med molle och chilla en stund.
Sen åkte ja o mamma o molle ut till stallet, red en GALET överpigg SJUKT het ponny KANON idag.....haha finss ju inte så mke att säga, ni kan ju föreställa er själva ;) Så fort ja NUDDADE litelitelite med skänkeln så ...PANG va han iväg XD Men efter ungifär en halvtimmes hård träning va han liite lugnare :D

Formen va de inte fel på iaf, bara att han va som en tickande bomb...;)
Men de e ju så han är ibland, min älsklings ponni<3

Denna veckan ser hyffsat lugn ut i skolan faktiskt, ingen skola i morn, Gymnasie besök hela dagen!
Sedan är det bara en vanlig torsdag med engelska glosor. O sen e det fredag, o då e de ju helg lixom ;)

Kommer en liten rolig sak senare, såhåll utkik !






/emma

Länk, till ALLA som kommenterar

vem är jag?
vem är JAG för dej?? hur känner ni att jag är som person genom bloggen?
hur verkar mitt tänk ,min personlighet..ja enkelt, VEM är JAG för just DEJ?

xoxo Erika

schabrak,..

dehär schabraket ifrån HÖÖKS är RIKTIGT snyggt tycker jag! ser lyxigt och DYRT ut, men det går på det fjuttiga priset 229:-!! Lätt att det finns med på julklappslistan!

detta HV polo schabraket... LOVE IT! passar grymt till min utrustning, mörkblå kavaj me lila detaljer, silver mörkblåhjälm, gaah så perfection! kostar väl runt 600;- tror jag, o det finns definitvt on my list!

detta schabraket tycker jag är riktigt snajsigt! stilrent, men ändå tufft- loove flaggan! Sveriges flagga på.. what ever, spelar ingen roll va den sitter på, snyggt allways! tror att detta ligger på tuny 800-1.200:-, listan-ofc

xoxo Erika





----->hej<-----

home from school,... SEG dag.. men goosh va ja har skrattat idag!
Haft svenska läxa/test/prov, gick faktiskt riktigt bra, yeeey!
annars hade vi Matte, diagnos.. USH, NO- USH, SO-USHUSHUSH, rast- love it
snacka om att ja o sandra hade en galet OSERIÖS dag idag, skrattat massormassormassor, gjort bort oss, fixat friends-haha.. om nån vill va våran vän vill säga xd

nu- flingor+mjölk, modelljakten on da dator
sen-rida,rida,rida
after that---> mat hos farmor and farfar

efter de blir det MASSOR av ENGELSKA PLUGG!! USH på de me..
va gör Ni idag då?

kommer inlägg sen.. långt.

xoxo Erika

Bigbig day yesterday

okej, igår... slog NI besöksrekord med hästlängder! Så SJUKT grymma är ni, tack!
image descriptionimage description


Erika o Emma

Sjukt.

Tycker allt detta med att Cajsa inte ska få behålla sitt guld är sjukt. Hon visade ju att hon var bäst, så enkelt är det.
Nej Ush på den som startat allt detta. Hoppas den är nöjd nu. Förstöra för en 13-årig tjej som VUNNIT SM.

Nejnej, FYSKÄMS på dej som börjat allt detta.

/emma


blir många svar på tal nu, men -->

Anonym om Guldvärd.:
Vill absolut inte lägga mig i sådär eller starta något bråk. Endast uttrycka mina åsikter.

Inom hästsporten, speciell ponnyhoppning är det alltid ponnymammorna som är värst. Det är säkerligen en ponnymamma som suttit och kollat upp hennes resultat vilket egentligen är förjävligt. Men sen å andra sidan så tycker jag lite och så regler bör följas. Menar kan en hoppa med bara två nollor så kan flera. Jag själv vill megamega gärna hoppa msv men fattas en nolla i la fortfarande men inte startar jag för det. Det var säkert så för henne bara att hon ville hoppa SM. Många vill hoppa SM, det vill jag med. Men reglerna är satta för att följas. Förstår henne mamma/tränare missförstod men tycker de flesta bör veta om TR på den nivån enligt mig :)
Anonym:
Jag känner Cajsa, och hennes mamma, och det va rinte så att hon hopapde msv bara för att hon ville till SM, även om hon inte var kvalad, utan hennes mamma hade inte riktigt koll på reglerna på ponny, utan trodde att det var tre placeringar, eller två nollor i LA, för så är det på storhäst. Och jag tycker ändå inte att en föreldra miss i regelverket ska drabba henne, för det var ju inte hon som gjorde "fel". Hon VAR bäst,. + Att det borde ha stoppats redan innan tävlingen började, eller under, men inte efteråt när det var avslutat och vinnaren var klar.

förstår hur du menar, och dessa inlägg är till för att uttrycka känslor och tankar.
kram Erika

svar på tal

Anonym om Guldvärd.:
Regler är regler och de är till för att följas! Väldigt tråkigt att en liten flicka ska bli drabbad, jättetråkigt för henne. Men man måste tänka på de barnen som faktiskt VAR kvalade som missade medalj p.g.a detta och silvermedaljören som blev snuvad på SITT guld...
IP: 217.209.159.104
21 November, 20:24  
a l e x a n d r a om Guldvärd.:
det är klart att regler e regler, men vafan om hon vann hela skiten, behövdes den där sista nollan verkligen då?!
IP: 83.176.242.135

Alexandra:
exakt! en sista LA, vad spelar det för roll?? Hon är 13 år, varför ska HON straffas, det va väl inte HON som gjorde fel?? Och dessutom så nolalde hon warm up i LA+kval I LA, så hon va ju kvalad då! bäst i sverige bland B-ponny, det visade ju hon klart, så det är väl klart att hon ska ha GULDET?

Anonym:
Joo... MEN det va ju EN nolla i LA som saknades, o hon nollade dessutom LAwarm up+ LA kval I på SM, så då va ju de fixat. Och att hon visade ju både i kvalen TILL SM o PÅ sm att dom ÄR bäst, BÄST i Sverige= VÄRDIG vinnare! Om då cajsas mamma inte hade förstått att man skulle ha 3 nollor, eller misstagit sej, ska verkligen Cajsa straffas för det då? det är väl inte hon som är "felet"?? Och jag tycker då i den saken du sa:
"Man måste tänka på barnen som faktiskt VAR kvalade som missade medalj p.g.a detta o silvermedaljöreren som blev snuvad på sitt guld"
Joo, MEN hon VAR ju faktiskt kvalad till SM, så det va ju klart på den biten. Och att jag tycker det är VÄRRE att stå framför fullsatta läktare, få sin GULDMEDALJ,rida ärevarvet,bli intervjuad,få alla priser,va lyckligast i HEEELA världen, o sen måste man lämna tillbaka ALLT o inte stå som vinnare längre, än att komma två, för man är väl glad för de ändå, o han(Tom) visste ju antagligen inte äns om att hon inte nolalt 3 LA, utan bara två, så det är nog ingenting han går o tänker på precis, jag tror nog därimot att det känns jobbigare att ta emot en "begangnad" medalj, inte få uppleva sitt ärevarv eller lyckan över att VINNA SM, utan bara få priserna på posten, då försvinner ju all glädje o lycka? För det roliga är ju att uppleva känslan DÅ?
+att jag fortfarande tycker att det är äckligt och pinsamt av denna vuxna människa att sitta o snoka upp sådana här saker BARA för att sätta dit en 13 årig oskyldig tjej, USH!

xoxo Erika

Tidens fanns inte idag... Sorry

Fanns ingen tid för bloggen idag. Ledsen för det.
I morn blire mer kan ja lova!


Hörs!


/Emma


snabbis... hörs later on!

ut i stallet nu, rida tre...---> sen in o plugga+städa rum
hörs om en stund!
image description
xoxo Erika

rätt ska vara rätt.. men detta är INTE rätt

Anna om Guldvärd.:
Fast regler är ju till för att följas, synd och bli ifrån taget ett sms guld, men saken är ju den att fortfarande har hon ju vunnit det, bara inte spelat rätt.
IP: 81.228.204.193
Hej anna!
jo de är väl klart att regler är till för att följas, men nu var de ju så att de trodde att man behövde tre PLACERINGAR(så var det för 2-3 år sen)så dom trodde att hon var kvalad till msv, eftersom hon hade tre placeringar. Och jag kan då tycka att det är väldigt onödigt att ta ifrån henne guldet då LA kvalen, 3 nollor, är för att man ska visa att man är redo att hoppa msv, o om man då sedan nolalr två msv o kvalar sm, o sen nolalr 3 msv på SM, den svåraste tävlingen på året, OCH omhoppningen som säkerligen va på 1m-1.10! O de som stör mej mest, o nästan äcklar mej är att NÅGON pellefjonk satt sej o SÖKT upp,letat o GRANSKAT alla hennes rundor o räknat nollor, bara för att SÄTTA DIT henne!!?? det är bara avundsjuka, ren o skär avundsjuka.
kram Erika

Guldvärd.

okey.. nu har de hänt igen, eller igen..har det hänt förut??

Som ni flesta vet, så VANN min övergrymma vän Cajsa Soberon SM 2011 kat. B!
hon var bäst, dom var BÄST HELA sm:et igenom, nolla warm up, nolla kval I-VANN stilen, NOLLA kval II, NOLLA finalen, NOLLA omhoppningen o VANN HELA SKITEN!
fick alla priser, red sitt underbara ärevarv, det där alla drömmer om, hon fick uppleva det o åka ifrån Helsingborg som världens lyckligaste tjej, ,men som i alla sagor finns det onda varelser.. inte en Han eller en hon, inga människor utan vi kallar den DET
DET åkte hem ifrån Helsingborg satte sej framför sin lilla dator, klickade sej in på ridsport förbundet o LETADE UPP Cajsas resultat ifrån tidigare starter, gick NOGGRANT igenom alla resultat,.. "aaah 0+0 fel där ja, skit oxå, aaah 4 fel! YEEEES, aaaah 8 fel, UNDERBART,aaaah 0 fel, skit"
O sedan gick DET in på TR, letade upp kvalregler för SM, gick sedan tillbaka till resultaten, tittade norggrant o märkte till sin förtvivlan att hon faktiskt VAR kvalad till SM, damn, aja fortsätt leta.... tittar på kvalen o märker att "aah hon har bara nollat TVÅ LA:er, man måste nolla TRE!"
Sätter sej o skriver in en protest mot SVERIGES BÄSTA B-PONNY RYTTARE, protesterar mot att hon faktiskt bara har TVÅ nollor, o man behöver TRE!
O vad ska dom göra? Ridsportförbundet måste ta emot o göra rätt, o rätt va i detta fallet- Låta Cajsa LÄMNA TILLBAKA SINA PRISER!!!
Hob blev alltså IFRÅNTAGEN sitt SM GULD!!! SM guld- once in a life time, vem 17 gör såhär??
Hur kan DET, en VUXEN människa(förmodligen) Sätta sej o skriva en protest imot en 13 årig tjej, som nyss vunnit det största som går, SM!?? HUR KAN MAN?? Hur har man hjärta att krossa någon, trycka ner någon o stjäla något så stort? helt helt helt sjukt om du frågar mej!@@@@@@
Jag är så sjukt frustrerad,arg o framför allt LEDSEN för Cajsas skull, jag kan inte ens leva mej in i hur det känns... FY F*N!
Jag hoppas verkligen att DET är glad nu, för nu blev det ju som DET ville? GRATTIS till dej!

jag blir så sjukt lack på människor som inte klarar av andras framgångar o lycka, som inte kan låta människor vara glada o lyckliga, utan måste ta ut sin avundsjuka o förstöra för andra... USH

gaah nej, Cajsa, du har mitt fulla stöd.. jag finns helt klart för dej o är så GALET mycke på din(rätta) sida..<3

xoxo Erika

morgon update.. snart skola

dagen ser ut like this:
skola-08.45-16.00
S T Ä D A rumemt...-.-"
Rida 1-4 beror på hur många ja hinner... måste verkligen städa
PLUGGA ENGELSKA

go dag.. fortsett ifrån städningen då.. som gör typ heela dagen, men aja..
image description
hörs later on!

xoxo Erika

.

.


Underbara människa!

Fick det här av Erika igår ,(man ser armbandet i kanten av bilden, super fint<3) plus blingstenar att sätta på iphonen!:D

Så sjukt fint, eller hur?

Ska sitta på vägg , ska bara hammra upp en spik den hänga på!

Tak Erika du är B.Ä.S.T.<3

/emma


Nya shortsen

Nya shortsen--->
LOVELOVELOVELOVE till dessa... gaah
älskar dom verkligen, sitter som en smäck,snygga,tuffa värre!!
Känner att jag verkligen ahr snöat in på USA kläder nu, men oh my va snyggt det är!!
höööögt upp på listan står en galet snygg stickad USA tröja ifrån...daddaaddaaaaam GINA TRICOT OFC!

xoxo Erika


hur tänker man???@@

fyy F*N rent ut sagt.. vem, VEM VEM VEM har hjärta att göra så??@@@@@@@@@@@@@@

xoxo Erika

pink kaaaninis

okey, hemma från Billdal efter en liten tur med Eve o jackan.. CR 70 80
gick brabra, båda va duktiga o de har verkligen lostnat nu, tagga greva nu!
gårdagen:
var på Borås ridhus, i 2 timmar o tittade.. tog åt oss o lärde---> sen direkt till Knalleland, mötte upp Emma på My one, hon fick presenterna o sen gick vi o ficka lite, eller emma onyttigade sej med daimtårta o cola, ja tog en sjuktgaletcrazy varm cappuccino, haha xD
Gick lite i affärer o köpte ett bar riktigt yammi yammai short,.. skoja bara.. DOM ÄR LOVELY, gaah lovelovelove
köpte även en senapsgul halsduk, hur mysig som helst.. o eftersom jag är snålheten själv så va 50 :- alldeles lagom (a) HAHA

tacktacktacktack Emma Ängeln Sahlberg för en grymis dag.. and OFC Evelina den grymma Zetterström Sandèn<3

idag blire väl såhär:

clearrund med eve o jacky
äta
chilla
rida dröm
rida kakan
rida carro
rida harry
cilla (a)

kommer vara en lugn hästhästhäst dag, bara hästhästhäst.. tror jag iaf ;)

image description
världens grymmaste... MÖÖÖSSSOOOOR yeah! om ni ser en vandrande rosa gris o en tiger på greva så vet ni vilka de är (aaaaa)

xoxo Erika

Hemma nu..

Efter sjukt lång men rolig dag!
Började med att va me min fina Erika o gå runt o shoppa lite o snacka o så.
Underbara människa<3

Sen direkt åka till Emelies place för filmkväll! Me eme då så klart, Lisa, Vincent och Adam.
Rolig kväll , försökte titta på film men de gick ju Inge vidare, blev la mest prat ;)

Nu MÅSTE ja sova, galet trött.

(tack mamma för du hade hand om Molle medans ja va borta<3)

TACK TILL ALLA SOM GJORT MIN DAG GRYM!


/emma


Lite svar o så..

Anton-ia om Khairo hoppträning:
Erika, du ska väl till Baltic?? <3 :D
IP: 46.194.129.102
18 November, 22:54
Matilda om Khairo hoppträning:
Det är sjukt hur galet duktiga o grymma dina hästar och du är ! Du lever i en dröm ! :D
IP: 78.72.47.24
Antonia:
Tja Anton! Yepp yepp, baltic blir det, Carro+ Khairo.. är du där oxå??:D Saknar dej <3

Matilda:
Hej grymma du! Tacktacktack så jätte mycket! Sjukt roligt att höra! :D

just det "Du lever i en dröm"...
är någonting jag kom o tänka på nu.. när jag såg denna sockersöta kommentaren.
Ibland glömemr man bort allt det bra som händer i ens liv, alla saker man är bra på, allt gott omkring en..
man ser bara allt det tråkiga, hakar upp sej på dåliga saker och glömmer att tänka efter hur bra alla ANDRA saker är.
o denna kommentaren fick mej att tänka, hur bra man har det ändå.. med A L L T
Jag har grymma vänner, sådana jag kan lita på, som jag älskar... o som älskar mej- för den JAG är, jag har en grym familj,grym skola..  amazing hästar, riktigt amazing,vi bor i ett grymt land.. rättvist, nej inte riktigt men mycker bättre förutsättningar än många andra. ja de är mycke.. riktigt måmga saker som är G A L E T bra i mitt liv.. o det är viktigt att se dom oxå.. se all glädje, för då finner du mera!

image description
xoxo Erika

KLICKLKLCIK*

Här kommer vinanren av LÄNKNINGEN... DEN HÄÄÄR TJEJEN
Den första som hade rätt+ hade en blogg! here u go girl

KLICKKLICKKLICKKLICKKLICKKLICKKLICK
xoxo Erika

Whoo's That chick???

Gissa tjejen, den som gissar rätt först får en FET länkning!!


Kul in Borås


@ Borås ridhus

*rida Dröm
*fixa mej
*åks till Borås på nån grej
*Borås centrum med Emmi<3
*buss hem--->rida tre
*chill

Va gör NI idag?
Btw, ni har blivit riktigt bra på att kommentera..keep up the goodwill work, för nu är ja på GGGG!

Xoxo Erika


Today is a new day..

Idag ser dagen typ ut såhär:
Vakna
Äta frukost
Gå ut me Molle
Duscha
Träffa Erika o Eve
Rida (kanske)
På kvällen dra till Emelies place o ha mys kväll !


/emma


God natt o lite till...

Först, grymt kul o se hur mke statestiken höjs! Riktigt många är ni nu, sjukt kul!

Men nu ska ja krypa till kojjs...
Blir stan i morn med MIN BÄSTA FINASTE GRYMMASTE AS COOLA BÄSTA VÄN ERIKA WENDERYD<3

Håll utkik på bloggen då, haha kommer nog komma en del bilder o filmer kanske, vem vet? ;)


GOD NATT!




Galet gammal bild på mig o erika.....


Du är bäst!<3



/emma

Lite mer om dagens ridpass..

Som några av er kanske vet så är Cooper lkite speciell va gäller att rida ut.....
Har inte gjort det ofta, blitt mest skritt turer med mamma gåendes brevid.
Men så i onsdags skrittade jag med Lisa ut en liten bit. Jag försöker bygga upp vårt (mest mitt) förtroende att rida ut tillsammans. Jag kan tycka att det är lite obehagligt när han tvärvänder helt plötsligt, stegrar as högt (nu snackar vi rakt upp) och sticker så jag absolut inte får stopp..
Men idag red jag ut med lisa en 30 minuter , UTAN att han ens försökte vända, stegra eller sticka :)
Sjukt glad ja är! Så detta var en stor "vinst" för oss.

Efter detta så red vi en 30 minyter i paddocken. As fin verkligen.
Finns inte ord för hur BRA han lyssnade och o hur bra han gick!
Gjorde mycket skänkel vikningar, öppnor, slutor osv osv..

GALET AS MEGA taggad till GREVAGÅRDENS CHRISTMAS SHOW 2011!!!!!!!

Jag har VÄRLDENS bästa ponny.... <3







/emma

Har ja sagt detta?

Att när ja fyllde år fik ja världens finaste text av erika... Gaaash !

Ni kanske kan få se den sen. Det beror på.

/emma


Grymma läsare!!

Amanda om go'natt:
Så galet grym är du Erika !! :D
IP: 217.209.23.68
Haha, tack goa du!! Tror nog att du är en grym tjej du me!
BIG kram Erika

Khairo hoppträning

Mål: SM 2012
Dröm: EM
Ponny: Drishoge Khairo
Ryttare: Erika Wenderyd
Hinder höjd: 1.25-1.30
xoxo Erika
(släng GÄÄÄRNA in en kommentar.. är inte förbjudet vettni)

toptoptop hästar asså

mina hästar.... är dom övergrymma eller??
Idag dåva.. hoppat Khairo o Harry, det gick väl ungefär SÅHÄR bra!
Khairo:
Red fram lite lätt o mjkut o jobbade honom lite, sen började vi hoppa på ett räcke.. tog nåra små skutt på 80 kanske, sen hoppa vi 1.10 en gång o 1.20 en gång.
fortsatte sedan till en oxer o hoppade den två gånger, en gång 1.10 o en gång 1.20... SJUKT fin va han!
Hoppade därefter en linje på 1.10 oxer till 1.10 räcke, o sen höjde vi till oxer= 1.25-1.30 o räcke=1.30, o han bara FLÖG över! sjukt gym! avslutade på en linje räcke till räcke på 1.25.. GALET nöjd med min ÖVERGRYMMA ponny!

Harry:
Det har blivit en sååå stor skillnad på harry nu asså! Han har börjat bära sej galet mycke bättre i trav o galopp, har faktiskt fått en riktigt rund galopp! Gjorde ungefär damma me harry som me khairo, men poå hinder mella 1.10-1.20, o som pappa sa:
"Såhär fint har han inte hoppat någonsin på hela tiden vi ägt honom", o de va verkligen sant! Han har ALDRIG hoppat så fint som idag, han vill vanligtvis gå i ett högt tempo med lite "B-ponny stuk" om ni fattar va ja menar, men nu har vi tränattränattränat maaassa dressyr o resultatet är T Y D L I G T, han bär sej mycke bättre o orkar vara lugn o rund hela tiden i galoppen, även när man hoppar.. o han kom upp riktigt fint idag, o backbenen bara stog raakt ut! så grym va han idag! Även Khairo hade grym teknik idag!
Dröm fick gå litet mysigt roligt pass i ridhuset... fin SOM VANLIGT
NU- IDOOOOOOOOL yeeaaaaaaah

Goo moooaaa, Amaaandaaa F, wooop
xoxo Erika

Todays news...

Skolan va rolig! (haha konstigt nog va??)
Direkt ut till stallet, o rida ut (!!!!!!!) o sen ett pass i paddocken.
Cooper va jätte duktig idag. Red ut UTAN att han tänkte vända hem eller stegra eller sticka....shhit duktig ponny.
Dressyren satt som ett smäck idag. UNDERBAR känsla! As fin va han verkligen!


Pratat en hel del me lisa, alltid lika rolig <3

Kanske (förhoppningsvis) kan träffa erika i morn.. :D
Saknar henne sjukt mke!<3

Hörs lite senare!

Ha en trevlig fredag kväll!





/emma

Dålig bloggning Today!

Update snart!


lite planen såhär dåva

Rida Khairo-hoppa
Rida Drömmis
Rida Harry-hoppa
Blogga-VIDEO blogg agaain
fredagsmys

hur ser ERAN kväll ut??

xoxo Erika(hörs snaart)

TOP 3!!

Erikas top 3 hästrelaterade bloggar right now
1. DENNA tjejen
2. THIS one
3. den HÄÄÄR
jag och min dröm kille <3

On My way,in daa bus

Sitter on da bus på väg till skolan,fick stressig morgon today me, så de får bli iphone bloggning....
Today är de tre hästar att rida,familje mys o fredagschill som de ser ut nu..
Dagens outfit äär:

Ljusa Jeans med strassdetaljer o lite sånt.. Rätt speciella
Höga overknee strumpor-svarta
Gulligt mörkblått linne me små fickor o rosetter,gulligt värre
Midjekort jeansjacka i samma färg som byxorna

Smycken o smink:

Flätat jeans armband
Pärlarmband
Swarovski armband silver

Mascara
Foundation(lite)
Kajal
Läppglans

And i'm ready for school! Hörs later on!
Xoxo Erika


go'natt

fail men aja, enjoy!
xoxo Erika

bigbig thanks

oh my.. inte checkat statestiken på typ 1-2 veckor, inte tänkt på de faktiskt xd
men NU tittade ja för skojskull, o vet ni va jag såg??
IGÅR slog ni BESÖKSREKORDET, STORT! grymt underbart, o tack tack tack för att ni läser våran blogg!
keep up the good work, så gör vi de me!
xoxo Erika

På väg, brum brum

fail-videoblogg--->på väg upp¨
ni får ursäkta att ja inte är så bra på att videoblogga, men aja ni får ta de somde är xd
om vi ska snacka om hästarna så red ja Drömmis o Harry idag, carro vila o pappa lösgalopperade Khairo i ridhuset...Drömmis va jätte fin idag, LUGN o lydig, red med en hand på tygeln o höll längst ut i skritt,trav o galopp o hoppade över löite små bockkar o så o tränade på att styra med vikthjälperna, lydig ponny? JA! Ökar inte tempot om man inte ber om de, går på tygeln all the time, kan de bli mycke bättre? njaae¨
Harry fick konis träning idag.. galopp runt runt runt runt o jobba, bra för honom!
imorgon blir det drömmis---> ut, kanske?
Khairo o Harry hoppa, wiihoo
får se kanske hittar på någonting på kvällen me becka o bella eller nått, men vet inte än hur det blir.
älskar bilden som förövrigt är tagen av Emma Sahlberg FÖRSTA gången vi träffades hemma hos mej... känns som de va igår, samtidigt som de va 1000 år sen!

NU ha rman ju börjat fundera på julklappar me... har kommit på en liten lista,alltid lika svårt! haha xd
o svårast av allt: Komma på va man ska köpa till andra!
Har  fixat, eller kommit på va ja ska köpa till de flesta i klassen o alla människor i skolan, okey inte alla men några
o sen så vet ja nog va mammi o pappi ska få, boror? INGEEN aning!
O Eve o Emma..o connyo lollo o ja... MÅNGA att lista ut! puh*

36 dagar kvar... yeey

xoxo Erika



"citat"

"if someone trying to bring you down, it's only means that you are above them"

xoxo Erika

hejhej förlåt

hej. jag vill börja med att förklara mej.. försov mej o vaknade 30 min innan bussen gick, så blogga va ju inte o tänka på... sen så kom ja på att de va konfa idag, så ja kom inte hem förens nu, färav BADBADBAD update
morgon- trött stressig
skola-seg, rolig o ja, rätt bra
konfa-hm.... okey

nu blire:

middag
rida khairo
rida drömmis
rida harry'
plugga

carro vilafr efter igår..


ja är på väg upp nu.. mina tankar är på bättringvägen, i alla fall lite
ja är posetivare,gladare o mer framåt.. men de är en faar way left
nu, NU, kör vi... let's do thiiiis

xoxo Erika

Erika FB Wenderyd---> It's so freaking true

Vi tjejer ...
Vi springer runt i huset medan vi borstar våra tänder.
Vi läser på schampo flaskan i duschen.
Vi skrattar åt våra egna skämt innan vi berättar dom.
Vi behöver ingen klocka eftersom vi har en mobil.
Vi kan läsa en mening 10 gånger utan att förstå den.
Vi trycker på dörren fast att det står dra.
Vi säger va? fast vi har förstått allt.
Vi hatar när vinden förstör våran frisyr.
Vi kollar i kylskåpet 10 gånger om dagen utan att äta något.
Vi kan se samma film 10 gånger.
Vi måste ringa till våra mobiler för att hitta dom.
Vi kan kolla på klockan för att sedan glömma vad den visade.
Vi vänder på kudden för att sova på den kalla sidan.
Vi sätter våra alarm tidigare så att vi kan ligga och sova längre.
Innan vi går och lägger oss räknar vi ut hur många timmar vi sover.

så rätt.. A L L T stämmer på mej... haha, tjej vare ja??

xoxo Erika

Svar om linnet

Lisa  (sokrates.star@hotmail.com) om två nya...:
Sjukt snyggt, vart har du köpt linnet?^^
IP: 83.183.103.124
Hejhej Lisa!
Tack! Ja har köpt linnet på Gina Tricot, kostade 149:-!

kram Erika

xoxo Erika

PANIK kväll!

okey...ikväll har ja vart med om de läskigaste någonsin.. har ALDRIG vart såhär rädd, NEVER!

Jag o mamma skulle ta in hästarna, alla ponnysar va inne o vi va påväg till hagen vid vägen där storhästarna går, o när vi är 20 m ifrån hagen ser vi bara två hästar springa rakt IGENOM staketet o upp på vägen, o det va KOLSVART ute! Dom började med att springa in lite på gården o mamma sprang o öppnde stalldörren, o ja kände "ah men nu är de lugnt", o de skulle ja INTE tänkt! dom vänder o sticker ut på vägen o börjar trava bort mot backen som leder ner mot statoil.. jag får panik!
Sen komemr dom tillbaka o travar iväg åt andra hållet på vägen, sen in på grannens gård o ner i SKOGEN i kolmörkret så vi kunde inte se dom, men ja hörde dom trava omkring efter en stund...
vi fick stanna ALLA bilar så att de va en LÅÅÅNG kö på vägen, nån ringde in till radion så att dom ropa ut de där..
sen så sprang dom omkring, ut på vägen o ner på en annan äng på andra sidan vägen, ut i skogen o så höll dom på i 40 minuter... 40!! o tillslut lyckas jag få tag på dom då dom stannade nere vid conny o Elvis vid skogshagen... o my gad vilken lättnad de va! Asså det va helt sjukt så rädd jag va, vilken panik ja kände o ja bara gick runt o störgrät o skrek o bara va helt panikslagen! Trodde att båda skulle bli påkörda eller sticka ut i skogen, o va gör man kl.18 en onsdagkväll när de är kolsvart ute o två hästar sticker ut i skogen?

detta fick mej att tänka på hur hjälplösa vi är egentligen.. vi handskas med djur som väger ca 300-600 kg, är något större än oss,snabbare o starkare. o vi är helt hjälplösa i sådana här situationer.. heelt hjälplösa!
så alla som säger att "ridning är ingen riktigt sport", ridning är iiiiinte svårt! de är ju bara att sitta o guppa me, de är ju ändå hästen som hoppar osv osv
prova att rida då.. sitt upp o rid mot en trekombination på 1.30 med en häst på 550 kg o 1.67 i mankhöjd, prova att stå där helt hjälplös på en äng o skrik i panik för att du inte kan göra någonting.. testa de o sen säger du va du tycker om hästar o ridning!

tänk värt.

xoxo Erika

två nya...

hade mitt nya örhänge på mej idag, köpte de föra veckan tror jag.. en enkel earcuff med två små kedjor o en liten vinge på... men gjorde om de lite o satte dit fler kedjor o lite små diamanter, blev riktigt nöjd faktistk..
här ser ni lite till av örhänget... yammi på de
o så köpte jag även ett nytt linne igår, reptilmönstrat i svart o vit, o hela ryggen är bara svart spets typ, love it!
dagen ser ut såhär..eller eftermiddagen/kvällen blir de ju:

Rida Harry
Ruda Khairo
rida Carro
rida Drömmis
chilla
blogga
duscha
SOVA

känner mej lite halvsjuk o försov mej idag.. därav ingen bloggning under dagen...!

hörs snart! xoxo Erika

Cooper - vila

Idag får Cooper en vilodag. Han har inte gjort det på ett tag nu. Så nu va det dags :)
Ska åka ut och bara pussa på honom<3

Skolan idag va okej som vanligt. Badhuset.. Uuuuuääk.
Men ja överlevde 30 längder haha!
Sen sista lektionen va engelska o hade prov. Men de gick bra !

Hörs senare.

/emma


Cooper todayy

Han va super duktig, pigg, men bra.

Skrittade ut först med lisa, o sen ett pass i paddocken. Så fin!
I morn är det vila för hans del som gäller. Då ska ja RÅ PLUGGA matte provet.. Får la se hur de går ;)

Hörs om en stund!

/emma


nu sover jag... njaaee men snart!

sorry for bad update... men ja r lite smått sjuk,trött o allmänt seg så
då får de bli såhär...
har ju inte visat er mina senaste tillägg i min ridgarderob:
En Charles owen air8 navy leather(puh långt namn) hjälm!!wiihooo, finally en ny hjälm, love it! I mitten under nätet är den silvrig(a)....
Veredus Pro jump bakskydd, bruna till Harry+Khairo.. Antonia tipsade om dom, o för henne funkar dom super så jag hopaps att dom är bra! :D
thanks mum and dad<3
dagen har vart bra annars.. seg men bra
Harry va.....gaaash ja tror att någon har bytt ut min ponny! Han brukar vara så stel i sidorna när man sätter igång honom, men idag.. oh my! Han bar sej galet bra i galoppen, o traven ska vi nte snacka om! Stora(för att vara Harry) kliv ifrån början o PÅ TYGELN I FORM! underbar känsla!

Carro har ju haft en återhämtningsvecka efter ängla så hon fick bara skritta trava ogaloppera lite..gick bra men lite stel va hon allt lilla stora tjejen.<3

O Khairo... Khairakhairokahairo
han va som en explosiv BOMB idag, minsta lilla grej, att de prassla till lr vad som helst---> PANG så stack han lr busa osv... BUSE!! Imån blir det lösgalopp innan ja rider de är en sak som är säker!

NU----> DUSCHEN
sen---> SOVA

nighty nighty!'
xoxo Erika

dageen

Morgon- ont i halsen o gaanska trött
Skola- kort dag, hem 14.00... matte prov idag, svårt men de gick bra! Fick även reda på resultatet ifrån ett NO prov vi hade för typ 2 mån sen.. man kunde ha max C på detta provet o ja fick... C (a) happyface
NU-Kungsbacka me mammi, ridsport+kungsmässan yeah
SEN- Rida Harry,Khairo,Carro... chilla
hörs sen, nu måste ja dra!
kommer massa senare, lite tankar osv..
och IDAG är jag SJUKT glad, vet ni varför?? :D

xoxo Eriika

God morgon!

Precis käkat frukost, o nu blire åka till skolan om en liten stund.

Fy vad trött jag var i morse. Har nog aldrig vart så trött! O jag är en sån människa som har sjukt lätt för att gå upp på morgonen. På helgerna sover jag inte länge, vaknar senast kl 8 , sen händer de ju att ja kan sova lite längre ibland ;)

Vi hörs senare!


/emma


Dinner time..

Blir äckel mat idag... haha!

Vart själv hemma hela kvällen då mamma har stått i BHC kiosken (ishallen) o jesper o papap har kollat på matchen.
Jag o andra hand stekte upp 2 hela paket med bacon o luffsade i mig som ett odjur....
Men de blev jag ju fårståss inte mätt på ;)
Så nu när mamma åker hem har hon köpte äckel mat (Mc Donalds) till mig så ja kan äta lite..ibland får man va onyttig ! haha !

Dags att gå ut me lilla Molle igen...
Vi kanske hörs senare, om inte,


GOD NATT!





Världens bästa lag!



/emma


Favoriter - Vinterbilder!













Snart blir det underbara snö bilder på Coopisen med! :)





/emma

..

Jag tycker Erika skrev sjukt bra om att ALLA kämpar.
Väldigt bra inlägg faktiskt. Tror många kan tänka om lite där.

Hur som helst, jag är sjuuuuukt skriv sugen, har ni några förslag på vad jag ska skriva om?
Det blir ju intressantare för er om ni tycker det är kul lixom ;)

Snart kommer några av mina favorit vinter bilder upp här!






/emma

Vad krävs?

För att du ska nå dina mål?

Förutom TID, SVETT, BLOD & Tårar?

Jag ser på det såhär:

Du måste TRO på dej själv.
Kämpa, försöka 100 gånger om tills det sitter och fungerar!
Ha tålamod och ha en plan.

JAG har människor soom tror på mig! JAG tror på att jag kan bli något.
Jag kämpar varje dag när jag rider för att bli bättre.

Vad tror ni?

Detta fungerar för mig just nu iaf, får väl se vad som händer i framtiden!








/emma

me myself and I

Min största fiende är... jag
jag är själv min största fiende, mitt största motstånd o är ivägen fpör mej själv många gånger..
har svårt att se mina bra sidor, för att se vad jag gör BRA o vad som jag faktiskt kan, skit svårt.
Jag sätter ofta stopp för mej själv o brgränsar mina möjligheter bara för att jag fastnar i negativa tankar,för hur lätt är det inte att trycka ner sej själv i skosulorna o bara va tråkig o negativ mot sej själv? hur lätt som helst om du frågar mej.
Jag jobbar hårt för att komma ur detta, o jag har mina underbara vänner som stöd... o det betyder sjukt mycke<3
har lixom kommit in i en ond cirkel där jag först o främst ser det "dåliga".. typ som när jag kommer ut ifrån banan så är det första jag tänker od et första jag säger(oftast) vad som jag inte va nöjd med..why?? Inte en aning faktiskt..sjukt onödigt..
så detta är det jag jobbar med mest just nu, mitt största "problem".. ode t är jag?
jag sätter så höga krav på mej själv,tänker.. fööör mycke,granskar allt jag gör,hur jag ser ut,vad jag gör,när aaalt! o jag är nog för prefektionistisk o det är det som gör det svårt... så från o med N U ska jag försöka bli bättre på att vara snäll o positiv, mot MEJ SJÄLV.. knäpp sak att säga men, it's true
snackade med min älsakde Louise precis, förstående x1000, bästa råden o underbaraste tjejen.. du är guld värd!
nu sticker jag ut i stallet, o sen ska jag ställa in, gå igenom passert o BARA se ALLLLLTT bra! från o med N U
xoxo Erika

merci

karolina (kaarolinaj@live.se) om nr 1 på min lista:
Jättebra skrivet Erika!
IP: 46.194.158.247
Tack.. TACKtacktack! Underbart att få lite uppskattning för det man skriver, so big tack!
kram Erika

Klar i stallet!

Klockan är kvart i 5 o jag är redan klar! Skönt!
Slutade skolan 10 över 2 idag, veckans tidigaste dag. Skolan va helt okey, alltid tråkigt med lektionerna oså klart, men fy tusan va ja o Emelie höll på idag xD haha ni vill nog inte veta ;)

Direkt efter det blev det åka till min prins Cooper<3
Haha han va på spökhumör idag när vi red.... Han ville inte gå längs långsidorna av paddocken, och absolut inte längst ner! Pigg som tusan va han ju oxå såklart!
Busen!

Nu blir det hem och plugga engelska! Uppdaterar när ja sitter vid datorn sen.

/Emma


nr 1 på min lista

det är få saker som jag verkligen stör mej o blir irreterad på... inte många alls
men EN sak som jag tänder till på o blir frustrerad över, de är när folk skriver på sina bloggar, FB,kommentarer what ever- Åh du är så mycke bättre,jag är så mycke bättre,vi är sååå mycke bättre än alla dom dära bortskämda ungarna som bara styr runt sina självgående SM ponnysar o bara vinner... dom bryr sej inte om att lära sej rida för hästarna löser allt o dom kämpar inte osv osv

då blir jag riktigt sur faktiskt.. för ALLA kämpar, kanske inte lika mycke eller med samma saker, men ALLA har sina egna problem,egna svackor,egna grejjer att förbättre- ALLA
O vem säger att det är såååå lätt att bara "styra" runt sin SJÄLVGÅENDE sm ponny?? Ehhm??
det är ju inte så att alla b,c,d ponny ryttare bara "styr runt" msv B-msv A o vinner heela tiden, för då hade de väl aldrig vart några fel på tävlingar?
att inte vi, ni,dom alla, har problem med sina hästar, att dom bockar av dom,stannar,river,inte går att lasta,inte kan jobba i form, inte kan si eller så.... eller är det så många tror att det är??
jklart att det är JÄTTEJÄTTE roligt att ta fram en häst själv, att utvecklas med hästen ifrån början, o göra allt tillsammans för första gången, MEN man är inte bättre än alla dnra o man ahr inte RÄTT att uttrycka sej om att aaallla sm,nm,em ryttare är såå bortskämda o bara åker häst... för att dom inte tatt upp hästen själv?? Men tänk såhär då, när du väl fått upp din häst, kommit upp till sm nivå o allt dedär som DU har som mål, va ska du göra då? Ställa av hästen i en hage o låta den gå där för att INGEN sedan vill köpa den, för att det ger så dåligt rykte o ingen vill ha en "färdig" häst? nää, alla ska ta upp dom själva o sen ställs dom av,... bra förslag?
jag har sagt det här förut, o detta är verkligen en sak jag stör mej på, för jag själv rider på SM nivå, hoppar de högsta klasserna på ponny.. o att då läsa blogg efter blogg,kommentar efter kommentar av hur dåliga vi är bara för att vi inte att upp hästen själv,.. det ÄR sjukt tråkigt!
o dessutom, hur vet NI att inte vi tatt fram våra hästar, eller har EN till häst som vi jobabr med vid sidan av?
Jag tex hade Jarad o Drömmis att tävla SM o större klasser med, o SAMTIDIGT så utbildade jag jackpot(evelinas ponny) o jobabde honom uppåt vid sidan av lixom.. fattar ni grejjen? Samma sak nu, jag har Drömmis,Khairo o Harry som jag hoppar högre med, o är påväg upp med, o sen så "utbildar" jag Carro(i tävlingssammanhang) o jobbar tillsammans med henne frammåt, för hon är som en unghäst, allt vi gör nu är första gången, första vinsten,första 1.30 osv... o jag har massor av grejjer att träna på, Harry jobabr jag i dressyr, försöker få till kontakten mellan oss o få oss frammåt, Khairo är speciell, o jag har precis kommit på honom ordentligt o vi har förstått varandra, men jag kämpar massor med honom, o Drömmis..han inte helt lätt heller.. för det är väl ingen häst? O sen har jag carro, hårt jobb för att få henne mjuk osv.. ALLA har vi våra grejjer!

tycker att alla är lika.. vi alla kämpar.. vi alla gör detta för att- Vi älskar det, vi älsakr hästar,vi älskar sporten... ingen är "värd" mer för att man gör si eller så, nopp¨
såhär känner jag just nu.. massor mer att skriva, mend et tar vi en annan dag.

jag kämpar varje sekund,varje ridpass,varje start.. jag vill frammåt o jag, känner iaf att jag INTE glider på någon räkmacka.

kram Erika

Måndag morgon.

God morgon på er!
Ush vad måndagar är jobbiga! Bläääää
Det är jobbigt att gå upp , vakna, göra sig i ordning, gå till bussen, osvosv...

Idag är vår kortaste dag, 14.10 slutar vi. Börjar med samling, sen engelska, NO, svenska och matte. Typ i den ordningen!

Kan ju säga att det tog såhääääääääär lång tid att göra detta inlägget, jag hann äta, och göra mig iordning o massa mer. Så nu när ja skriver denna mening är jag redan vid bisshållplatsen! XD

Vi hörs senare !

/Emma


SM 2011, im back

Jag är tillbaka... har inte haft nått internet, därav ingen uppdatering.
jahopp.. då va SM 2011 avklarat, mitt sista SM med Drömmis..
ni kanske vill ha resultat?:

Warm up: 0 fel, SPÄND o liite seg va han här pga att han tittade på alklt runtomkring, stog två bilar inne på banan+ en stooor equipe"vagn" o lite annat, men vi nolla o ja, han va fin!

Kval I: PIGGTURBOPONNY.se, han va sjuukt pigg, faktiskt FÖR pigg... Körde lite sitt eget race o jag hade inte så mycke att säga till om, men 1-7 va ändå bra, sen på 8:an så va det en väldigt kort sväng till en stoor oxer o så stog en bil i hörnet som va läskig, så vi kom inte ut i svängen-my bad
kom fel, båda hängde frammåt o ja, ett stog blev de.. sen så va det en ganska kort sväng fram till 9 a b c, jag tryckte till med skänkeln mitt imellan 8-9, o då bockade han.. kom HELT fel pga de o ja, vi va ute ur matchen.... men för övrigt hoppa han bra

hoppade därför ingenting på lördagen, man kunde hoppa en LB men det kändes onödigt..

B-final: HUR FIN SOM HEEELST!!! Gaaah va grym han va här, de va en a:0 så vi sattsade reejält! Red faktiskt riktigt fort, tog snävaste svängarna, vände skit kort runt stöden o han va grymt taggad, alldeles lagom pigg o lydig, meeen så pilla han ner 8:an(NÄST SISTA) sååå lätt, den rulla av o ja 4 fel blev det men en toppen runda att avsluta med.. MEN hade vi inte rivit, ja då hade vi haft en fjärde placering med oss hem.. fasen oxå! men ponnyn va yammi all way!

packade ihop allt efter att jag hade ridit o sen drog vi oss hemmåt----> bytte om @ home, sen konfa grejj 4-7
nu sitter jag här hemma, hungrig,trött o allmänt seg.. men gladare än va jag vart på länge- känns gött!
o ett STORT FETT GRATTIS TILL ALLA MEDALJÖRER:

B-ponny:
Guld- Cajsa Soberon , Rinroe Rock it
silver- Tom Svitzer , Oliver
brons- Julia hallberg , Flying Dragon

C-ponny:
guld- Alma Ljungberg Atlas
silver- Kajsa Andreen , Nosy Nobby
brons- Zandra Svensson , Sputnik

D-ponny:
guld- Frida Mårtensson , DRISHOGE Bobby Sparrow(DRIISHOGE)
silver- Philip Carey , Flamingo Fly
brons- Katarina Bork , Istoriah La Bree

SJUKT MYCKE GRATTIS, o CAJSA SOBERON som gör sitt FÖRSTA o sista B-PONNY SM, VINNER! GRATTISGRATTISGRATTISGRATTISGRATTIS!!!

o alla andra som gjort grymma rundor, kämat o allt, grymt jobbat!

Nu lämnar vi SM 2011, går vidare o siktar frmmåt---> Baltic cup, sen christmas show yeah
(bilder o lite filmer kommer ifrån SM:et snart, även lite shopping resultat)


min finaste älskling... du är en DRÖM

xoxo Erika

Sjukt otaggad....

På skola i morn..-.-
Uuäääk blä usch!!!

Tur att man har VÄRLDENS finaste Cooper som ger en styrka!<3

Btw; Cooper va hur galet fin som helst idag! Tränade på lite av det som Daniel Zetterman sa till mig. Allt stämde idag! Guldponnyn!

Ni glömmer inte att följa SM via equipe va?

/emma


Sundaayyy**

Söndag..
A-/B-final
Packa ihop allt---> back home
byta om lite snabbt o sen raka vägen ner till Sätila- Konfirmations sak
Rida Khairo
Rida Harry

ingen aning om hur humöret är idag.. hur det har gått lr någonting, men.. hope for the best

vad har NI gjort i helgen då??

finaste<3

shiit, ännu en galen helg över.. tiden går sjukt fort.. fast lagom,ibland
xoxo Erika

En bild säger mer än tusen ord.

Kärlek<3


en...

...sak som jag vill uppleva igen: GP-ponnyn
...person jag saknar: Emma Sahlberg
...låt jag älskar: Adele-Someone like you
...B-ponny jag gillar(inte mina): Flashy gold finch
...storhäst ryttare jag ser upp till: Rolf-Göran Bengtsson
...känsla jag ofta känner: Kärlek
...tävling jag minns extra bra: Änglahoppet 09/11, SM 08/09/10,Baltic cup Drammen
...låt jag taggar till: Eye of the tiger
...låt jag bliy lycklig av: Simply the best
...blogg jag läser varje dag: www.kenzas.se
...dröm jag har: Ta medalj i SM på ponny,Hoppa SM med storhäst
...sak jag försöker leva upp till: Vara en bra vän, alltid
xoxo Erika

God morgon!

Vaken sedan kl 6... Så är det att ha en galen valp som är super pigg då! xD

Vi hörs senare..

/emma


efter sjukt lång go dag vare dax för....feest

Är med friends... har sjuuukt roligt, hörs imorgon
YEAH

xoxo Erika


REFLEXER!

Ni glömmer inte att ha på er massor av reflexer nu va?

De är good stuff!

/emma


*<3*

Everything I do, I do it for U<3
you mean so damn much for me... du kan inte ens föreställa dej,..
nevermind I found someone like U<3


Hellu

Va i skolan i början av dagen, sen gick jag hem. Nu ligger ja i sägen med Molle brevid mig. Myyyys<3
ska berätta om träningen senare, den gick AS bra! Cooper<3

Hörs sen!

/emma


wish me luck??

SM kval I msv B bedömning- Fel och stil

då vare dax... första kvalet, drömmis är:
knoppad
borstad
pälsglansad


alla grejjer är putsade o fina, outfiten ser ut såhär:
Whitaker träns
prestige sadel
veredus skydd
marinblått/ljusblått anna scarpati schabrak
GG(?) brösta med ludd

min outfit:
blå animo kavaj
vita animo ridbyxor med blåa detaljer
mountain horse stövlar-svarta
sporrar
svart jacson spö med ljusblå strasstenar
blå roekl handskar
blå whitaker hjälm
blå racesafe väst


ute SM 2011, 4:a i kval I!:D

xoxo Erika


ny dag, nya tag

Morning.. idag vare dax för:
frukost
fixa i stallet
hoppa warm up LA
hoppa kval I msv B
skritta drömmen
skratta sjukt mycke
vara galet glad
putsa
krama min fiinaste<3

vad gör NI idag?? kanske är någon av ER här i Helsingborg??
xoxo Erika

Lev din dröm, dröm inte ditt liv

"Don't be afraid of dreaming..."

I will follow my dream
go my own way... the way that i choose, the right way.. for ME





xoxo Erika

Inget internet -.-"

okey.. de här är galet tråkigt, ingen dator funkar.. elelr asså nu gör den de, men vi ska åka om 30 min så va hjälper det??
Jag får dra dagen lite snabbt...
Skola till 12.00(åkte hem vid lunch)
Rid DRÖMMIS
packa skåp
packa kläder
packa lastbil

bara lastbilen kvar, sen bär det av mot inomhus SM 2011, kanske vårat sista sm?
Helgen kommer bli GALET fraking as rolig! ALLA vänner är där, nästan.. bästa ponnyn o allt på TOPP
och självklart hörs vi under helgen!! Live bloggning+tidsinställda..

xoxo Erika

Hej på er.

Mår lika dåligt idag :( ont i hyvvet som satan! :( men nöden har ingen lag så jag måste ut med Molle. Vart ute 2 ggr redan. Nu sover han så sött brevid mig.
Får se hur mycket jag orkar blogga idag, ska försöka så Mke jag kan iaf :)

/emma


LÄS

http://www.nt.se/sport/artikel.aspx?ArticleID=5760107





:D




/emma

2 grymma tjejer!

Som sagt, jag diggar mångas ridstilar och det finns sjukt många duktiga.

Jag börjar med tjejen jag alltid skriver om som min förebild.

Erika Wenderyd

Vart ska man börja?
Hon har sjukt bra KÄNSLA, ruskigt snygg rid stil.

Hon vet vad hon gör, visst alla kan göra misstag, men här snackar vi focus vaje sekund av hela banan.
Sen har hon ju grymt söta ponnis oxå ju som är duktiga!
Men det räcker inte bara att ha en duktig ponny, man måste ju kunna rida oxå.
Och det är precis vad Erika gör, RIDER. Varje steg.

Helt galet bra är hon, o ja vet att hon kommer bli ngt stort i hästvärlden.

Och som gräddet på moset, är hon även min bästa vän. <3





Martina Åhs

Japp, Coopers förra ägare.

Diggar henne sjukt mke!
Martina är jätte duktig, rider så grymt snyggt och VÄL.
Vet precis vad hon gör, och när hon ska göra vad.
Hon red cooper skit bra, o de e mitt mål, bli lika duktig som henne så jag o Cooper kan komma långt.
Hjälpte verkligen när hon hjälpte mig på Ängla. Hon kan ju Cooper så hon vet ju vad jag ska göra lixom!
Men hur som helst, hon är ruskigt grym denna tjejen :)










/emma



Dagens Molle!

Så här söt kan man va ja...



/emma


dagen::

hre I am.. datorn funka inte i morse.. men nu är jag tillbaka
eftermiddagen/kvällen er ut såhär:
Stallet- rida Harry/Khairo
packa-inför SM kläder/Stall+dröm saker
Stallet- rida dröm
Plugga- sos prov imån...xd

inte hätte intressant dag, lot's of thing to do... o maassamassamassa tidsinställda som kmr upp under helgen

hörs ssnaart"
xoxo  Erika

Änglahoppet 2011



image description

image description

image description
















Underbara lilla häst, jag älskar dej av hela mitt hjärta <3



/emma

Sitter i soffan nu!

Precis vart på en hyffsat lång promenad med lill killen Molle<3 Kan ju inte gå för långt än då han bara är en liten bebis :)

Jag hat sjukt många förebilder i ridsporten, av dom som jag känner.
Ett inlägg om detta kommer senare!

Nu ska ja fixa alla bilder från Änlga så dom kommer upp om en stund! :D


/emma



Sjukiiis

Hemma idag. Jätte ont i hyvvet och mår illa :/ Men ja ska ut o gå med Molle nu så lite frisk luft kanske är bra?

Cooper ska ridas i paddocken idag om det fina vädret håller i sig. Markarbete.
I morgon blir det hoppteäning för Anna Emanuelsson :)

Hörs senare!

/emma


Biffie<3


God natt världen!

Ligger med min lilla valpis Molle i sängen. Och nu är de bed time. Sjukt trött. Huvudvärk o illamående är jag oxå. Jaja, de är nog borta i morn bitti.

O bara så alla vet, så saknar ja min bästis Erika Wenderyd!!



/emma


hoppat harry

Hoppade Harry-Han va lugn, lite stark men annaras super fin! inga stora hinder idag, bara på ca 90-95 o lite smått för att det är roligt och en bra lydnadsträning!
nu ska jag rida khairo---> sen plugg@@
image description
saknar<3¨

hörs snart... måste skynda ut o rida innan det blir natt.. NATT

xoxo Erika

liten erika.. vääldigt liten erika

haha, såg att sandra(hon till vänster) hade taggat en bild på oss, när vi gick i 1-3:an xD
va säger ni? Samma tjej??
xoxo Erika

jag....

mår inte bra... känner mej lite illamående, har ont i magen o ja.. inte bra helt enkelt
sjukt jobbigt,.. men jag hinner vila 30 min till innan Eve kommer o rider, ska rida Khairo lr Harry med henne, sen rider jag den andra med mamma o carro vid 9 tiden.
Vart o galopperat Drömmis har jag iaf, han va SJUKT pigg o MESIG xd
haha han är för söt, blir rädd för småsmå saker, gull<3
imån är de onsdag, rida 3 hästar + packa ALLT inför SM 2011...igen
yeepp, om 2 dagar är det dags igen, sista sm:et med Drömmis.. vilket gör det sjukt speciellt, men det tar vi inte nu.
såhär seer dagarna inna/SMet ut:
Onsdag- packa+rida
Torsdag- skola till 12, sen rida 3, åker vid 4 tiden
Fredag- warm up ÖA+ SM kval I msv B
Lördag- Kval II Msv A
Söndag- A/B-final + konfirmations sak när jag kommer hem o sen rida Harry + Khairo

yepp, så ser det ut just nu... SÅKLART kommer LIVE update ifrån SM:et!

xoxo Erika

Haha!

Vem har sagt att hundar inte kan rida? ;)

Molle & Cooper satsar på SM 2012!!!


snabb check

Dagen:
Skolan- okey seg trök dag, men ja... okeey
nu ska jag:

Rida drömmis på Gustafsson galoppbana
Rida Harry
rida Khairo
plugga

hörs late ron, nu är de brooottomm

happyface*

xoxo Erika

Söt som socker.

Och en liten dampis ponny!
Är anmäld till greva nu, hoppar;

Torsdag LB
Fredag LA
Lördag LA
Söndag LA

Längtar ihjäl mig!

För min ponny är den bästa i världen!<3

/emma


Skit på allt.

Ja hittar inte min svensk mapp. Jag hatar skolan. Skolan suger!

Ja vill bara vara i stallet med min bästa vän. Cooper. <3 han får mig att må bra. Och jag njuter av varje sekund med honom . Han är det bästa som har hänt mej. Han är den som får mig att orka kämpa.
Älskade ponny <3


dagens.........

Dagens outfit:
Vit gullig spetsklänning från Nelly.com
Svarta TUNNA tights
overknee strumpor svarta
svart,silver,vita armband
svart poncho/sjal

dagens frukost:
Cornflakes
Hallon
mjölk-laktosfri
te

dagens humör:
trött,seg,lite lagom taggad.....

dagens mening:
"Killar är som toaletter, antingen är dom upptagna eller så är dom fulla med skit"
-Louise


xoxo Erika

liten snabb genomgång av toodaay

Dagen har vart såhär:
Upp tidigt-fixa massa o så innan skolan... SEG tjej? JAA
Skolan- Okej dag, hade ett oförberett prov, haha ingen kunde mer en hälften så det gör vi om imorgon xd
Chilla-skööönt
Rida Drömmis- Lite lätt markarbete idag, hoppade igår(som gick AWSOME föresten, hur fräch som helst!)
Rida Harry- Red med gramanen idag, LÖS såklart.. hoppade lite små "bockar" och dressyrjobbade honom
Liten "mini spa" behandling av mej själv.. mmmh
NU, kvällsmat hos farmor o farfar (a)- Bacon + ägg

hörs sen, bye!

xoxo Erika


FB

Fatta hur sjukt FB är egentligen... hur mycke man kan ska/lyfta personer genom bara ett.. ETT klick??
Facebook är sjukt grymt med det att man lätt kan hålla kontakten med alla friends, real friends i verkliga livet, o man kan hitta nya vänner.. som jag o emma, vi hittade ju varandra genom BDBD, o nu är vi helt GALET sjukt grymt bra bääästa vänner.. så bra, det är det ju
Man kan peppa,lyfta o stötta folk genom att puffa,kommentera,gilla osv... men alla dåliga grejjer då??
Jooo, hur LÄTT är det inte o bara sitta framför datorn med en skål chips o bara trycka ner folk? Hur lätt som helst, för du slipper ju se personen i ögonen, du slipper ha alla vänner omkring, du behöver iinte alls stå för det du gör, för det va ju bara på datorn... o du kan inte använda kroppspråk osv
Klicka dej in på din mammas systers kusins mormors son sons flickväns dotters FB o skicka iväg en random kommentar: Du är sjuuukt ful, bitch!
O du har tryckt ner den här tjejen i skorna fullständigt... DET är ju sjukt
eller när folk missbrukar gillaknappen... typ som
" Jag kommer sakan dej min älskade finaste vovve... Vila i frid" o så gillar folk det?? vadå gillar ni att hunden är död eller vad?? Att hon saknar den kanske??
det är ju då man ska kommentera, finns för dej, <3 , osv, visa medkänsla o gilla INTE
Eller när folk ändrar sin status från "i ett förhållande" till "singel" o så gillar 46 st de.. eehm??
tycker man måste tänka efter, vad är det man "gillar"?? vad är det man skriver?? Kan du STÅ för det i VERKLIGA livet, face to face?? Vet du vad konsekvenserna blir??
be careful, FB is a BIG power

xoxo Erika/FB nörd

Anmäld till Grevagården!

Precis anmält mej o Cooper till Christmas Show i Greva! Ska bli AS kul :D

Massa mysiga människor där :)

Idag fick coopisen skrittas barbacka i en höstig paddock! Massa orangea löv:) senare får ni massa bilder från Änglahoppet!

/emma


Ekorren<3

lycka<3
xoxo Erika

morgon----> outfit osv

jahopp... då va det skola igen då... SJUUKT taggad, eller inte
dagens består av:
Leopard jeans
Swarovski skärp
söt mörkblå blus/tröja
Gul spetssak att ha under
peace halsband
swarovski,pärl,och ett silver svart armband
två ringar

o dagen ser ut såhär:
Skola
rida Drömmis
Rida Harry
chilla
plugga


hörs later on!

xoxo Erika

Åååh ja dööör va snygg!

Världens finaste ponny. Utan tvekan.
LA+5!

JAG ÄLSKAR DEJ COOPER<3


Foto; Lovisa Brännström


Har du fotat?

Har DU vart & fotat i helgen på Änglahoppet?? Skicka Jätte gärna till e.sahlberg@hotmail.com

SJÄLVKLART länkar jag er !

/emma


det värsta som kan hända...!!

Rest In Peace Hickstead- The Worlds Greatest

Helt sjukt, fy f*n va hemsk.. vi kan aldrig skydda oss.. aldrig!

vi tänker på dej.. o din tappra ryttare Eric<3
xoxo Erika

min underbara dag.. nej, HELG

Här får ni dagens sjuka resultat:
Vi börjar med carro:

Carolyn Winning round 1.30(msv B) FINAL

våran andra, och hennes andra 1.30 någonsin... STOR SVÅR bana kan jag säga! Men hon va G R Y M, kom lite stort på 3:an o fick därför inte tillbaka henne på 3 galoppsprång fram till 4:an, så det rev vi.. sen hoppade hon så långt på a hindret o längde sej lite o rev därför b hindret, och sen så fick vi även ner 7:an för att jkag inte riktigt kunde bestämma mej ifall jag skulle korta eller  länga, o därför kom vi liite nära.. men de andra 10 språng va hon 456457.6867 m över! sköt mej ur sadel o bara va allmänt galet grym! jätte nöjd!

Drishoge Khairo winning round msv B(1.20) FINAL

Okey, jag vet inte vad jag ska säga?? Han va så fantastiskt otroligt galet grymt sjukt underbar idag! Lagom pigg, lyssnade tillbaka o bara flöt på med GRYMMA språng! NOLLADE grunden, o kvalade därför till MSV A!! Gaah bara det va ju underbart! O rundan va verkligen en drömrunda, allt bara stämde heeela vägen! Eftersom vi nolalde blev det även en omhoppning för oss... 1.20-1.30 låg hindren på... petade ett litet räcke, men lika GRYM va han här!! O vet ni vad??
4 fel i omhoppningen räckte till.... EN VINST! Jag o Khairo VANN änglahoppet 2011, finalen! jag är så SJUKT lycklig!
Vi kvalade till msv A, Fick till en drömrunda,Vann MSV B,första vinsten, FINAL.. sjukt!

O priserna?? Jo ett GALET fint exclusiv täcke, svaret med rött o guld på kanten+ ett BACK ON TRACK täcke som kostar 2000:- i butik, bara det är ju sjukt??

så min dag, har vart gaaaanska awsome.. nej inte min dag, min HELG!
tack alla, hästarna,vännerna,sponsorerna
xoxo Erika
P.S, har DU bilder på mej?? Skicka dom gääärna till berggren.wenderyd@telia.com

Resultat Änglahoppet Lördag & söndag!

Igår vart cooper jätte fin, 1,2,3,4 & 5 va AS bra, va även debuten i LA+5. Sen efter de till 6 la ja handen (ajja baja emma) Så ett stopp. Sen slarva han på 7 på bommen föll. Sen i 3 kombin fick vi inte plats till b-hindret, det va jätte kort och han hann inte ens få upp benen, men hoppade ändå. Duktiga lilla ponny.
Men ja va nöjd med denna rundan :)

Idag va han så jäääädra fin! 
Martina hjälpte mej o gav mig tips oså, det hjälpte jätte mycket!
Sen så Hoppade han super fint hela banan,, o allt satt, o gissa vad?!

VI NOLLADE! :D  Så jäkla härligt! 2 utanför placering!

Första nollan i LA nu, på en NATIONELL tävling, o en svår bana.
Jag är stolt över mig & cooper.

Tack Martina, du är bäst! :)







COOPER MIN ÄLSKADE PONNY<3






/en övelycklig emma

Resultat från igåår

Gårdagens reultat:
Carolyn 1.25 kval II A:0

Framhoppningen gick sådär.. men på banan va hon helt annan o hoppade GRYMT!
Blev ett missförstånd på 4:an, hon blev stark o de va trångt på en linje så jag tog tag lite extra o då missuppfattade hon o lyssnade tillbaka lite fööör bra, blev lixom en uppstanning o därför blev det alldeles för långt ifrån, hoppade av typ 1,5-2 m ifrån o drog med sen översta bommen, sammalde ihop oss o hoppade 5,6,7,8 a b c,9 924835736 m över o jag kände "I'm flyyying", galet häftigt var det! Sen så hoppade hon lite för kort på 10 a o tog bakbommen, så 8 fel men GRYMT fin va hon! andra gången hon hoppar såhär högt så jag är nöjd!

Drishoge Khairo LA+5 Kval II A:0

Red lagom fort, lite innanför, lite galopp men ändå säkert o inte för sattsande! Nollade o blev 6:a av 75 starter! :D :D Han va SJUKT fin, aaaallt stämde idag, underbart härligt!

o det grymmaste av allt va att BÅDA gick till A-FINAL, Msv B(1.20) för Khairo o 1.30(Msv B) för Carro... 130 shit asså....
mål med Khairo: nolla
Carro: Komma runt med ett bra flyt(andra gången hon hoppar 1.30 i sitt 11 åriga liv, så jaa)

Wish me luck??

xoxo Erika

idag o igår..

okeey, datorn ville inte alls igår... så  därav den galet sega updaten
Men dagen ser ut såhär:
Mocka+fixa stallet
Putsa,packa,fixa Khairo
Tävla Khairo, FINAL Msv B
Tävla Carro
Hoppa Drömmis
Dressyrjobba Harry

Som vanligt en full dag, full med galet roliga saker och galet bra människor.. yammi

Igår kväll åkte Världens underbaraste Louise med mej hem efter tävlingen o sovöver
hade sjukt kul, massa snack,film, o sååklart så red vi Jerry o Drömmis xd
Tack för en G R Y M kväll världens finaste Lollo<3

vad gör NI idag??
xoxo Erika

<3

Ofta minns vi dem... På morgonen... På natten när vi tittar på stjärnorna... Ett datum... En låt... En plats... En doft... Varje timme, varje andetag... Till minne av dem som har lämnat oss. Sätt in detta på din sida, om du saknar någon som ser dig från himlen idag ♥♥
mina änglar.... jag saknar er så obeskrivligt..<3



gårdagens resultat:

Gårdagens Resultat:
Carolyn LA Warm up(1.20)

Hon va lite stark o frmmåt, men lyssnade ändå ganska bra.
Hon har lite svårt i kombinationer ibland med att korta upp sej så hon rev c hindret i kombinationen för att hon blev för lång, sen så i nästa komb. hoppade hon så snätt på A hindret så att jag slog foten i stödet så att de välte -.- Sen så utgick ja för att ja kände att de ändå inte spelade nån roll i warm up'en när vi ändå hade fått 8 fel!

LA(1.20) Kval I

OH MY vilken bana va?? 9 hinder i grunden, en trekombi. o en 2 kombi. o totalt 12 SPRÅNG i grunden! o i omhoppningen var det 7, SJU språng! så totalt 19 språng på MAX höjd hela banan igenom! DERBY? Haha xd Vi NOLLADE grunden, o i omhoppningen blev jag lite sen i en sväng o vi fick därför ett pet, men annars va hon GALET pigg,fräsh o SJUKT fin!! kom på en 13:de plats så en liten vit rosett blev de! :D

så nu taggar vi 1.25 me CArro today, LA+5 me Khairo, yeeah!!

xoxo Erika

Morning alla

Borsta Khairo
Packa Khairos saker
lasta----> borås
Tävla Kval II LA+5
hem
Borsta+ packa Carros saker
Lasta----> Borås
Tävla 1.25
Hem
Hoppa Drömmis
mys kväll med LOLLO <3

full,gó,galen,härlig,lång,kall dag framför mej då... woop

va gör NI idag då?? Nån av er i Borås kanske??

Min ponny?? xd

xoxo Erika


nattinatti

GÒ NATT!
dax för liten tjej att sova, vart en lång dag o imorgon väntar en ny... hörs
xoxo Erika

Har några bilder på Fröken Wenderyd??

Har du FOTAT mej?? Skcika Jätte gärna bilderna till Berggren.wenderyd@telia.com

xoxo Erika

länk

vill du följa Änglahoppet?? Klicka HÄÄÄÄÄR
xoxo Erika

nåra sanna grejjer

jag älskar flingor. HAHA
kan helt seriöst äta upp ett stort cornflakes paket på en dag xd... gaah, vad hade jag vart utan flingor?? Nä, inga flingor=ingen erika
Mitt största hinder på banan,i skolan,i livet är jag själv. HAr väldigt lätt för att vara onödigt tuff mot mej själv,ställa höga krav osv...någonting jag kämpar med vaarje varje dag!
ehm... jag har ALDRIG sett en skräckfilm.. aldrig någonsin in my life! Brrr... fattar inte grejjen, allt är asläskigt,man är sjukt rädd o får dödsångest typ,skriker,o sen så får man mardrömmar xd KUL grej de där med skräckfilm, eller?
min favvo låt är helt seriöst den här:
hur taggad blir man inte eller?? mmmh
xoxo Erika

Resultat Änglahoppet

Dagens LA gick GALET AS MEGA fort! XD haha! Han slarva lite, sen måste jag få ihop honom. För det går för fort för att han ska hinna lyfta på benen. Men han blir väldigt stark o så här pigg har aldrig varit! Men nu ska jag hoppa LA+5 i morgon & LA på söndag. Jätte bra att ha Erika där ska ni veta! En liten guldklimp<3
Sen får ja massa tips av Martina :):)<3

/emma


Catwomen


halloween outfit'en

Inte så svårt att se vad jag är va?? xd
xoxo Erika


Är DU i Borås denna helgen??

Resultat Khairo Kval I LA A:0/A:0

Idag kändes de bättre, nollade grunden, lätt som en plätt xd
kom bra på alla hinder, jämn galopp även om han är lite het o stark. I omhoppningen därimot, had evi två ner..
Han hoppade bra o så men vi kom på ett väääääldigt nära avstånd in i kombinationen o då höll ja kvar, han hoppade även om vi va typ under hindret, rev frambommen o tog två galoppsprång i kombin. sen så var det inte långt till nästa hinder o därför så han ja inte riktigt samla mej, såg ett sådär avstånd o försökte rida iväg på ett stort men han va klok nog att trmpa om o petade ävemn 10:an.. inte jätte dramatiskt men 0+8 fel blev de, o jag är nöjd med Honom o grunden, hade vart skönt med en dubbelnolla men aja..

Nu ska jag gå ut i stallet, mocka 3 boxar,packa Carros saker o sen åker vi tillbaka till Borås med Carro o hopapr 1.20 warm up+1.20 kval I
taggataggataggataggatagga
xoxo Erika

e t t å r s e d a n

För precis ETT år sedan bestämde jag mej.. det va dej jag ville ha<3


Harnells Tricky Dicky <3


Checklista-check

Frukost-check
Kläder-check
Packat- --
Borstat/knoppat Jerry- check
bloggat- check
taggat- halv check

NU sticker vi, Änglahoppet all day long.. blir en riktigt lång,go,kall,nervös dag idag, kval I med Jerry+Kakan, o warm up+Kval I me Carro, wish us luck?

Coacha Elin/Jarad
Tävla Khairo LA
Tävla Carro 1.20/1.20
Kanske rida Dröm
städa rum

Haha.. mjaaaau
xoxo Erika


Resultat torsdag

Cooper va väldigt pigg, (han rakades även igår) o 1:an, 2 går as bra! Ja tar en rätt snäv till 3, (de va på tid) o får inte riktigt med yttersidan, o ja klantar mej totalt. Ett stopp men heeelt mitt fel!
Sen drog han iväg till 4, så översta bommen flög ner. Resten av banan lyfte han på sina små fötter väldigt väl!
De gick ju som sagt lite väl fort ibland för han ville inte lyssna tillbaka, och jag hatar att behöva slita i munnen. Iaf resten av banan felfritt! Martina som hade Cooper innan är där oxå! Jätte kul o träffa dom , dom är super snälla:) Så nu taggar vi morgonens LA!!!


/emma


Resultat

Inte min o Elins dag idag asså... njaee inte alls!
Men ni sak få resultat från min sida här ändå:
LA Warm up A:0 Drishoge Khairo

Han hoppade SÅHÄR bra! Han va lite väl het o pigg men de funka..
red fort, riktigt fort faktiskt.. kom rätt överallt o allt stämde bra ända fram till 9:an, som va de NÄST SISTA hindret..
ja skulle svänga lite snäft höger, o han bara bet i bettet i vägrade svänga! Ja fick ta tag rätt mycke o fick ju runt honom i svängen(detta syntes inte såp mycke men det kändes!) o när vi vände upp mot hindret så var det egentligen att ta tillbaka på 4, men ja luta mej frammåt o tryckte fram på 3 SÅÅHÄÄÄR stora galoppsprång,.. o han stannade, för INGEN häst hade klarat att hoppa 3 meter ut.. o ja, ja åkte fram på öronen o trilla av, WIHO
Nolla 1-8, o ja, allt annat va ju bra så de känns ändå bra inför imorgon ;)


ingen bloggtävling då.

xoxo Erika

snart.. back for ya

Kommer ikväll när ja komemr hem ifrån Borås---->
Filmer

Halloween outfit, bilder

Dagens outfit Jerry/Khairo

tankar

hold on.. I will be back soon

En fråga.. till---> ER

Vad säger NI om en till bloggtävling??
Har en grym idée om hur den ska gå till o PRISET... så va säger ni, ska vi köra lr??

NI måste komentera vad NI tycker annars---> no tävling

xoxo Erika

Sa du nöt???

Drishoge Khairo/Ekorre??
eller?
*Lång nos,glugg mellan tänderna,liten nos,snabb som attan o ENORM svans,HYPERAKTIV.. ÄR han egentligen en ekorre??
xoxo Erika

To-do-list

Dagen ser ut såhär:
putsa+packa
klippa Jerry
åka med fam.G till Borås med Jerry, coacha warm up LA
Mamma kommer med Khairo o jag hoppar warm up LA
---> hem
Hjälpa Eve hoppträna Jacky
Rida Harry(kanske)
Rida Carro
packa putsa inför imorgon

mycke att göra idag, så inte mycke tid över till annat
kommer resultat update sen, and ofc annat oxå.. men, är nån av ER i Borås??
xoxo Erika

Hur söt?!

Socker söt!! han är helt underbar, o Ozzy gillar honom ;) men tycker att han är lite konstig! Han är redan lös överallt, räcker att man höjer rösten pyttepyttepytte lite så kommer han, o han håller sej vid mina fötter :)

/emma


Kakan

Denna filmen har jag sett X antal gånger... om o om igen,..
Cattis visade oss denna lilla ponnyn, vi föll direkt när vi såg den, härlig bjudning o grym teknik!
vi ringde direkt och åkte bara nån vecka senare tmed flyget till Irland.
Provade honom två gånger, först på eftermiddagen när vi kom fram, och en gång på dagen därpå..
han va lugn,eller ja lite som en piggare drömmius att rida vilket va p e r f e k t
hoppade några språng på räcke-oxer, 1.20-1.25 ungefär, han skötte sej super bra o jag va fööörälskad
han var inte busig,bockig,för pigg eller het,jätte lugn på gången o super i all hantering!
vi bestämde oss andra dagen för att vi ville ha honom o ja, efter två dagar lämnade vi Irland med en ny ponny, Drishoge Khairo
nu efter 6 månader har vi funnit varandra ordentligt, jag vet exakt hur jag kan o inte kan göra, vad som funkar bäst o vi har fått det att klicka helt enkelt.. men han är INTE enkel denna ponnyn, njaaee
lite busig,pigg o lite het,lite vild... men han är perfekt så!
Han har en grym energi, ett grymt hopp o massamassa vilja! Han ställer upp för sin ryttare vilket är galet härligt, han hoppar gaaah så underbart! Men visst är det skillnad från Irland till nu??
detta är ifrån våran första Msv B, i Juli.. o MYCKE har hänt sen dess! Nu har han blivit lugnare, stadigare,hopapr ÄNNU bättre och vi har fått in ett flyt nu, vi har helt enkelt lärt känna varandra
senaste hoppträning, goosh va fin han är! Men visst är det skillnad bara på dessa två filmerna?? Man ser att han är lugnare, stadigare och att vi hittat varandra mer, det ser och känenr iaf jag...
denna ponnyn känns bara så rätt för mej, precis som dom ska vara.. och det känns som att det här är bara början på många GALET roliag år!
nu taggar vi ÄNGLAHOPPET idag-söndag.. Drishoge Khairo<3
xoxo Erika

Välkommen hem

Molle<3


sammandrag Änglahoppet 2009

Änglahoppet 2009, alltså det året ja o Drömmis faktikst vann A-finalen! :D

kvällen, vad är kvar att göra??:
Rida harry
Blogga
duscha
sova
go kväll, hörs snart!
xoxo Erika

KBA med bella

Me
Myself
and I
hörs later on, in Kungsbacka nu
xoxo Erika

du ser ner på mej...

Who would have known how bittersweet this would taste?
miss u<3
xoxo Erika

snart jul ju :o

okej.. då var de november igen, helt sjukt va detta året har gått galet fort!??
hunnit med massor, släppa gammalt,hitta nya grymma vänner,skrattat sjukt mycke,tävlat,fått en ny ponny,debuterat 1.30 på storhäst,hoppat SM,vunnit guld silver o brons på DM.. ja listan är lång, året har vart grymt hittills

o nu är det bara FYRA meeting kvar, Änglahoppet borås... SM, Baltic cup o Grevagården Christmas show, o sen blir vintervila igen.. hmm
Änglahoppet börjar imån, hoppar:

Torsdag: Warm up Khairo LA

Fredag: Khairo kval I LA
Carolyn Warm up 1.20 o kval I 1.20

Lördag: Khairo kval II LA+5
Carolyn Kval II 1.25

Söndag: Khairo A/B-final LA lr Msv B
Carolyn A/B-final 1.20 lr 1.30

hoppas på att komma till Afinal med båda ofc, hade vart sjukt roligt! fast gadden 1.30.. kaan bli GAAANSKA stort, mmmh. Men vi tar de som de kommer, sjukt rolig helg blir det iaf!
Träffa massa roligt folk, lite new friends o annat nice, underbart!

kommer nån av ER vara där?? Kanske fota,vara funktionär eller tävla??

xoxo Erika


Harnells Tricky Dicky December 2010

gammal film på Harry... tror att det va 2-3 veckan med honom :D
har en ny metod här med filmerna då.. jag laddar upp dom på FB o sen---> bloggen, super smart huh??
xoxo Erika

Drishoge Khairo hoppar hemma

lyckades få filmen till FB, så de får bli såhär.. enjoy!
xoxo Erika

morgon again

Dagen:
Frukost
Rida en häst
Fixa mej
sticka till Bella
åka in till KBA kanske??
Rida två

så ser min dag ut today... chill,nice o rätt så lagom grym

försökte ladda upp en av khairos filmer förut men ja.. de gick väl likla bra som de brukar...@@@@@
ska göra ett till försök nu, o försöka ladda upp min halloweenoutfit+bild på tränset som någon önskade..
hörs snart!
kram Erika


nr.1



I heard that you settled down
That you found a girl and you're married now.
I heard that your dreams came true.
Guess she gave you things I didn't give to you.

Old friend, why are you so shy?
Ain't like you to hold back or hide from the light.

I hate to turn up out of the blue uninvited
But I couldn't stay away, I couldn't fight it.
I had hoped you'd see my face and that you'd be reminded
That for me it isn't over.

Never mind, I'll find someone like you
I wish nothing but the best for you too
Don't forget me, I beg
I remember you said,
"Sometimes it lasts in love but sometimes it hurts instead,
Sometimes it lasts in love but sometimes it hurts instead,"
Yeah.

You know how the time flies
Only yesterday was the time of our lives
We were born and raised
In a summer haze
Bound by the surprise of our glory days

I hate to turn up out of the blue uninvited
But I couldn't stay away, I couldn't fight it.
I had hoped you'd see my face and that you'd be reminded
That for me it isn't over.

Never mind, I'll find someone like you
I wish nothing but the best for you too
Don't forget me, I beg
I remember you said,
"Sometimes it lasts in love but sometimes it hurts instead."

Nothing compares
No worries or cares
Regrets and mistakes
They are memories made.
Who would have known how bittersweet this would taste?

Never mind, I'll find someone like you
I wish nothing but the best for you
Don't forget me, I beg
I remember you said,
"Sometimes it lasts in love but sometimes it hurts instead."

Never mind, I'll find someone like you
I wish nothing but the best for you too
Don't forget me, I beg
I remember you said,
"Sometimes it lasts in love but sometimes it hurts instead,
Sometimes it lasts in love but sometimes it hurts instead."

xoxo Erika

livet är inte alltid lätt.. /livet är aldrig lätt...

när allting sviker, är det skönt att ha en dream boy<3

xoxo Erika


I morn!

Kommer ja avslöja en sak här, jag är super glad. Så håll utkik!!!

/emma


I love you<3

Sötaste lilla pricken som finns.


--->hästar<---


sjukt värd att se... still think it´s easy?

xoxo Erika

shoppat (a)

okey dagen då--->

Gick upp runt 9, käka lite frukost.. liite
sen gick jag direkt ut i stallet o fixade iordning Khairo, hoppade honom idag
alla hinde rva på 1.20-1.30 o han va G R Y M
hoppade galet bra idag, fin överfina ponny <3
Sen gick ja in o bytte om, åkte ner till kungsbacka Börjes,Ridsport o sen Kungsmässan
köpte nåra grimmor o en present till eve på börjes bara..på ridsport blev det ett GALET fint träns till carro, wiihoo o ett par nya stövlar till mej, dessa blev de:

känns bra att ha ett par snygga läderstövlar igen, tretornen är ju sönder o på lagning.. men det blir bra att ha två par stövlar sen + skor o chaps..

sen på Kungsmässan köpte jag en foundation+lppglans o en mössa på H&M:

älskar mössor med pälsboll på huvudet.. men hatar äkta päls, o gilalr inte fuskpäls som ser för "fuskig" ut, men denna va fuskpäls o såg äkta ut, PERFEKT

mockade två boxar,åt liite middag o bytte vatten till jerry när jag kom hem, o nu ska ja städa lite inne o sen ut i stallet igen, premier rida med stövlarna på Drömmis o sen hoppa Harry lite :D
så idag blir det en vanlig,slapp go dag.. härligt

vad har NI gjort idag?
xoxo Erika
(film på Khairo kommer)

Hellu

Inte orkat eller haft tid för bloggen.
Träningarna för Daniel Zetterman va jätte bra! Cooper va lite busig men det gick bra! Hade en toppen helg med min bästa Amanda oxå! Kollade skräck filmer o Gick på bio o prata en hel del.
Bästa<3

Ikväll eller i morgon får ni en nyhet här på bloggen. Jag är super glad.

/Emma


Shopping With mum

Datorn funkar inte hemma..sorry
Men har hoppat Khairo idag,sjukt fin ponny ja har,helt galet! Kommer den I promise!om youtube vill...
Dagen ser annars ut såhär:

*shoppa me mammi
*mocka i fixa stall
*rida dröm
*rida Harry
*städa rum
*chilla

Rätt vanlig dag..skönt de me ibland
Hörs om en stund,när jag kommit hem o fått liv i datorn
Xoxo Erika


RSS 2.0