photoshop-----> next

sitter o fixar me photoshop, lite installation o så..
pappa hade ju bara "glömt" o säga att vi hade d, o vi har haft d i flera år
yepp, den lilla saken glömde han att säga till mej xd
men nu är d snart på g tror ja, blir riktigt nice,...
____________________________________________

tog ut Carro o lösgalopperade henne i ridhuset förut, grym kondis träning!
Jag måste filma henne någon gång när vi släpper henne, hon är ju så rolig!
först skrittar hon ett varv, sen travar hon lite, volter o vändningar o så.. o när hon har travat fram så
fattar hon galopp o galopperar varv efter varv efter var i säkert 7-10 min xD utan avbrott
o sen saktar hon av o travar av sej lite o efter d komemr hon fram till mej så skrittar jag av henne
är inte d rätt roligt ändå? xD
min fina Carro<3

nu blire te( mmmh..) o kanske lite hallon? (a)
o film, som jag missat typ 1 timme av men aja, ja fattar säkert ändå

oo sen, d bästa...------> sova

/Erika

har ni nåra förslag?

Bloggtävling på g...
men hur ska tävlingen gå till?
Kom med förslag...hur många ni vill.. no limits

/Erika o Emma

checkar some ¨things

Drar ut i stallet nu, rider Carro..sen vila

Darling, inga ord kan beskriva dej...<3


Hemma från konfirmation..

Japp, vart borta typ hela dagen XD

Kyrkan va sådär kul, men att sen äta med typ massa folk från släkten på mammas sida va kul :D

Va ju där för kussens skull, Elna :) (de va hon som konfirmerade sej)

Hon fick ett silver armband med en berlock på av oss, som hon kan fylla på själv sen ;)

Nu sitter jag i soffan o min rygg o fötter värker .... XD....

i morn blire en hyffsat lugn dag i SOLEN,

Och nu om en liten stund kommer familjen Piirainen-Olsson hit....

Saknat min lilla Jolin!

Haha fick precis ett sms från henne, o hon vill fiska krabbor XD HAHA

Men de blir väl att åka till kolj-ön med båten kanske, OM motorn lagas! När vi kom tillbaka till hamnen häromdagen så la den av bara ! Tur att de inte va mitt ute på havet bara ! ;)

Nu ska ja ta nåt att dricka, o dega i soffan.....


Och Komihåg: Ni e e bäst, o vi diggar er.










//emma'S

huvvet väger 5 ton

håller på att somna.. eller mitt huvve väger 5 ton känns d som xd
helt sjukligt trött nu efter denna helgen, kosta klasser,mycket starter för mej o inge riktig medhjälpare..
men d löste sej, tack alla underbara som hjälpte mej i helgen, ni är guld värda!

ska ta o sätta mej o äta nu, eller lägga mej i soffan o bara chilla
kanske blir till att dra ut i stallet o rida Carro sen.. eller Jarad xD
ska snacka me mamma, vet inte riktigt hur läget är..
oo ja måste bara säga, sry för kass liveupdate i helgen, men Ale-jennylund= noo täcking
så ja har haft nollkoll på everything, inga resultat från dagstorp,no bloggläsning,no livebloggning..
men nu är ja tillbaka igen, tröttare än någonsin xd

in Ale-J. befann sej nåra av d allra bästa.. d grymmaste
många gamla ansikten, nåra nya,nåra bekanta
tack alla, för en lyckad helg!
o grattisgrattisgrattisgrattis till maassa vinster o placeringa, ni är e l i t e

/Erika Wenderyd-bloggare på Www.siiimplythebest.blogg.se

......

falskhet varar inte länge


Ale-Jennylund, results

Yeapp, såhär gick d:

Harnells Tricky Dicky

Fredag: LB A:0/A:0 fin ponny, pigg,glad o gaanska stark men dubbelnolla o 4:a, fin ponny<3
Lördag: LA A:0/A:0.... ingen bra runda om ja får säga d själv.. inget riktigt flyt,han va inte taggad,ja va mesig..blev missar som kostade fel, för d är ju så d är.. men vi taggade om till söndagen ist
Söndag: LA A:0/A:0 0 fel i grunden o ett litetlitet pet i omhoppninge, hade kommit två annars.. men blev första utanför.. attans.. men jag är super nöjd med ponnyn<3

Drishoge Khairo

Fredag: LA A:0 super fin, verkligen! vände rupp stäft så han petar med bakbenen, tappar rytmen helt o kommer totalt fel så d blev två ner, men förövrigt väldigt fin!
Lördag: LA A:0/A:0 0/0 fel o riktigt fin! slutade 6:a<3
hoppade oxå Msv B... o han var helt u n d e r b a r blev tyvärr en miss in i kombinationen för att han lufthoppade preeeciis innan.. så han drog med sej frambomen o kunde inte hoppa B hindret, slutade på 8 fel som kom på samma hinder, annars ja,bäst
Söndag: Msv B A:0, ooh myy gaad min ponny är F.A.N.T.A.S.T.I.S.K o nollade! faktiskt en riktigt fin runda från oss båda om ja får säga d.. grymt nöjd!

Dream Boy

Fredag: LA A:0, fin ponny.. blev en onödig miss på nästsista hindret o slutade på 4 fel, skit eftersom han var så fin förövrigt..
Lördag: Msv A.... o ni måste tro mej när jag säger att han var g r y m..!! helt klockren, o d var ingen liten msv A, den va stor.. knepig o ganska svår! 11 hinder,13 språng.. han hoppade underbart.. men d hände en sak som ALDRIG har hänt tidigare
hoppade precis 8:an, vi hade fyra fel med oss efter 10 språng, hade 3 kvar.. o hade vi klarar d tre hade vi kommit vidare till omhoppning.. 8 stog mot ingången.. hoppar grym över hindret som var en trippel, landar,o jag fortsätter med att titta på nästa hinder som kom tätt bakom, o då.. mitt i linjen, bara VÄNDER HAN MOT UTGÅNGEN, o ja.. jag TRILLAR AV
f****sen! såå irriterande,o det va ju inte ens ett fel på ett hinder .. o han var klockren, hoppade grymt i denna svåra klass, kändes toppen, perfekt genrep innan sm,allt stämde,vi kom prefekt,bra galopp,han va taggad,ja va taggad... o mitt i detta så bara vänder han.. suck
meen jag tar med mej alla andra fina språng, kändes bara så surt när vi va 3 hinder ifrån en k a n o n runda..-.-

men över d hela så är jag väldigt nöjd med hästarna denna helgen, o ja kan säga att med en mamma med gipsad fot som enda vuxen med sej.. jag jobbade ganska tufft
så nu, är jag HELT SLUT
.

// Erika



På väg hem från grym helg, hold On resultaten kommer snart!

//Erika

sunday morning

aaaand im up,wii
trött tröttare tröttast men va gör d?
jag vaknar nog till liv snart, elelr d får vi hoppas iaf ;)
dagen spenderas i Ale-jennylund som ni nog redan har förstått..
LA me Harry o msv B me Kaktuss o Dröm, taggad som tusan
 vad gör ni idag då?

/Erika

nu sover jag, ZzZzzzZZzz


/Erika

Press, press, & jämföra mej....

Tänkte ta o erkänna en sak här på bloggen....För ER...
En sak INGEN vet..
Knappt mamma tror ja XD

Jag känner en OTROLIG press på mej när jag rider Cooper.

Bara för att många vet vem han är.
Många vet att han har gått typ 5 SM...---> Med BRA resultat!
Och Baltic....I lag.....
O Eliten.....Med väldigt BRA resultat, som har vunnit omgångar o Cooper vart en av dom som va säkra nollor.

O bara för det känner jag press, för att då måste de gå bra med mej på tävlingar, för att de har gått så bra med hans andra ägare.
MEN han är en svår riden liten ponny. 

Han är inte svår på det sättet att han är trög, o jätte tittig på hinder.

Han är svår genom att han DRAR med mej, väldigt ofta XD
Inte tittig på hinder, inte det minsta.
Men han har ganska kort galopp, o då känns de som de går ännu fortare, o Jag blir tvungen att ta tag i honom, vilket ja inte tycker om.... Fråga Erika, hon vet XD

Men det går BÄTTRE o bättre o vi börjar finna varandra nu!
Vi börjar bli ett TEAM. <3

O JAG tycker det är svårt att veta vilket tempo som är bra, för jag är absolut inte van vid att min ponny DRAR mot hindrerna, suger tag i hindrerna, o vill ingen annat än att hoppa!
Det är ju uderbart, men JAG är inte van än.

Ponnyn vet vad han gör, lite väl mycket ibland som bl.a Maria Gretzer och Anna Hassö sa till mej...

Men de e ju super bra. O jag älskar honom, de gör jag verkligen.

Någonting JAG måste lära mej, är att lita på honom, mer än vad jag redan gör.
Då går det ännu bättre, mer än vad det redan gör.
Och vi kommer ännu närmare varandra, mer än vad vi redan är.

På 4 månader har vi lärt känna varandra OTROLIGT bra, bättre än förväntat XD
Har redan mååånga fina vinster och placeringar!
Han är helt fantastisk, underbar, söt, snäll o en otrolig kompis med STOR personlighet !

Man ser på filmerna, hur mkt han INTE vill riva, SKA över hindrerna, utan att riva..
Kommer vi helt tokigt nära, kravlar han sej över som en ostbåge!

Och jag lär mig så himla mycket med honom.
Är otroligt tacksam för att jag har honom!

HAN är BÄST , helt enkelt.

Nu , ska vi bara vara BÄST tillsammans.


En annan sak är att jag jämför mej själv med andra ryttare, VÄLDIGT DUKTIGA ryttare!
Jag MÅSTE sluta med det assåå...

Jämför mej väldigt mycket med Erika, konstigt då, hon är ju bara FÖR bra asså!?
Hon kan sätta sej på en ny ponny o allt ser galet peerfekt ut från början, för Erika har RUTIN o kan OTROLIGT mycket! Hon rider så himla VÄL o bra.
Finns inte så mycket mer att säga än att jag ser upp till henne, GALET mycket.
Jag bad mamma hämta erika varje gång ja skulle hoppa i varberg, för jag ville ha hennes hjälp på framhoppningen och hennes tips, råd och HJÄLP helt enkelt.
Allt känns bara så bra när hon hjälper till, när jag hoppar, guuud värkar nästan som hon är magisk o vet precis va ja ska göra för att han ska lyssna på mej, o för att det ska vara BRA.
Och hennes ord efter min runda, dom betyder väldigt mycket för mej.
Vad jag gjorde BRA, vad jag ska göra bättre till nästa gång.
TAR ÅT MEJ ALLT hon säger till mej, för jag vet att hon vet precis va hon säger.

Hon är en förebild för mej.

Hoppas att ni orkade läsa allt... ;)




//emma'S






sm

hittade lite bilder från SM i årsta Runsten, enjoy it!

Msv A kval II

nolla i Warm up LA o SM kval I Msv B

Dream Boy<3

Sötnos nr !, helt seriöst, kan man bli sötare?

Drömmis- Igeeen<3

Jackan<3

/Erika

bra eller dåligt.. hm..

vad gillar ni inläggen om mina hästar? roligt eller baaara tråkigt?
ska jag fortsätta med Khairo,jacky o Carro me?

Ja/nej komentera thanks

/Erika

Dream Boy

vi fortsätter med Drömmis<3

Dream boy född 1995
Drömmis är importerad från Tyskland..
Men med Drömmis var det såhär:
En handlare från Tidaholm hade köpt in en "bil" med hästar från Tyskland
på den bilen stog Drömmis, men d var det ingen som visste, utan han åkte bara med på köpet för att ingen hade köpt honom...
hästarna lastades ur o d som inte var "beställda" släpptes i en hage..
Familjen Gunnarsson, skulle byta in en av sina mindre ponnysar o fick istället välja en ponny från hagen
Dom valde Drömmis, anledning:Han var söt
Då var barnen i familjen Gunnarsson 6 o 8(lr 9) år, o fick hem en tuffsig,liten 3 årig C-ponny vid namn Dream Boy
Drömmis blev inriden av tjejernas Mamma, o när han var inriden o trimmad fick tjejerna börja rida honom
Den lilla rufsiga tuffsiga magra 3 åringen från tyskland visade sej vara en riktigt bra ponny.. o bara efter 5 år, när han fyllt 8 o den yngsta dottern(Alexandra) fyllt 13(14) hoppade dom SM!!
när drömmis var bara 8 år gick han sitt första sm i Msv A(1.20)
efter Alexandra tog lillasyster Elin över honom o fortsatta på samma nivå som sin storasyster..
nåra år senare var det dags att sälja
Han blev såld till en tjej vid namn Matilda Osbeck, en tjej från Onsala
Matilda tävlade för Kungsbacka ridklubb, precis som jag
Drömmis, som alltid är lika jämn fortsatte likadant med Matilda
O efter några år så deltog dom i GP-ponnyn, o det var då vi såg honom för första gången
mamma dömde GP-ponnyn i Nordhalland, där dom var med.. o segrade
vi tänkte inte så mycket på det då, bara att det var en trevlig ponny
o ytterligare några månader efter det hade vi en träning hemma hos oss för Div I laget(som jag var med i) o Elit laget som Matilda o Drömmis var med i
Detta var andra gången som vi såg honom, o andra gången som vi noterade vilken fin ponny det var!
efter de två gångerna såg vi dom på nästan varje tävling, o när vi tillslut fick veta att han var till salu, åkte vi dit direkt!
jag blev förtjust, i denna sockersöta dröm prins
o tillslut blev det så att denna föredetta raggiga tuffs ponny blev min,min,min o bara min
hon han är helt underbar!'
tänk att han har gått på denna höga nivå i 8 år nu, 8 hela år
you are amazing Dream Boy


/Erika

såhär äre serru

tävlar all day long, så not so mush livebloggning
men hold on, d kommer annat!

/Erika

bilderna ja lovade.....

ÄNTLIGEN ville datoron samarbeta med mej! :D

Idag händer ingenting speciellt tror jag...Kanske skulle åka o shoppa lite elr nåt ;)

Och emma har varit duktig tjej idag igen.....gick upp TIDIGT medans hela familjen sov....& ut o sprang med Ozzy :D


Nu ska ja sätta mej ute o njuuuuuta av värmen o solen.

För än så är det ju sommarlov, right?






 ---> Jesper ser lite smått besvärad ut ;)
så söt så.



Emma.......vad har du lagt i korgen?.... XD






bye bye..


//emma'S

Emmas Svar..

   
 

Ingen fråga men ville bara säga att jag älskar eran blogg!!

Emma: du bloggar AS BRA!
Erika : du är cool


Svar: Kan ju bara tacka o buga!

 

 

 

Heeeej emma och Erika !
Va föredrar ni?
- guld/silver?
- häst/ponny? 
- R,L/peak?
- bajs/kiss? Haha

Svar:
1: Både och, det beror heeelt på vad de e det handlar om!

2: Ponny! Älskar alla dessa svåra & busiga ponnys, man lär sej otroligt mycket!
Har inte ridit stora hästar alls mycket...men red ju dom varje dag i 2 veckor hemma hos Anna och Emma Emanuelsson! O de va grymt roligt!

3:Tycker om båda, men kanske RL då ;)

4: haha jadu, riktigt klurig fråga den där du!

 

 

 

Hur är de med conny ?
Vilken klass går du i?
När började du rida?
Storhäst/ponny?
Vilken kläd märke gillar du mest?
(Typ som peak, R,L, H,L, )
Men välj själv av alla märke i hela världen haha!
Vilket kläd märke föredrar du i "häst världen"?

Frågor till emma!! :)<3 älskar hur du bloggar emma!! :)

Svar:
1: Conny har det toppen bra med söta Josefine!

2: Ska börja 9:an nu ;)

3: Så fort ja kom ut från mammas mage! Nä men Blev väl "seriöst" när jag var 8 år.

4: Ärligt talat har jag inte ngt Favvo märke, finns många ja gillar!

5: I hästvärlden gillar jag KL, HV polo, Mountain Horse , sen finns det många "icke" så kända märken som har bra kläder :)

 

 


Gillar ni:
Nellieberntsson.se/Nicholaistyle.blogg.se
isabellaochsara.blogg.se/michelleocholivia.blogg.se
skallerbloggar
facebook
bdb
msn
skype
ormar
spindlar
kaniner
hihi kuliga ´frågor till er båda!

Svar:
1: haha läser väl båda ibland
2:Båda ofc!
3: HATAR skvallerbloggar, skaffa er ett liv o tryck inte er andra?
4: FB = tumme upp!
5:Bdb =lite segt..
6: Msn e la bra!
7: haha skype har inte jag!
8: Ormar e skumma
9: LIVRÄDD FÖR SPINDLAR!
10: Ninisar e söta :)

Till emma <3 
Vilken är din favorit färg? 
Kram maria

Svar:
Marinblå, turkos, vit, röd.


Harnells Tricky Dicky

tänkte jag skulle skriva lite längre inlägg om alla mina hästar.. vi börjar med Harry

Harnells Tricky Dicky "Harry" född 2002
Harry är importerad från Irland, han kom till Sverige när han var 6 år(2007)
då blev han inköpt till en ridskola i Helsingborg där han skulle gå som ridskoleponny

Men när han kom till Sverige var han i ett väldigt dåligt skick,han var tufsig o rufsig,mager o nästan apatisk
'så d funkade inte att han skulle bli hanterad av små barn
Ägaren till ridskolan tog kontakt med Olivia(som vi sedan köpte av) o frågade fall hon kunde försöka rida honom.
o bara ett litet tag efter d så red Olivia Harry..
när hon tog hem honom så var han nästintill okontaktbar.. han vände rumpan till i boxen, d gick inte att sätta på grimma eller träns o man kunde absolut inte så mycket som RÖRA benen!
Olivia berättade när vi var där att vissa dagar tog det upp till 45 minuter att få på tränset, hon fick ta isär alla remmar o sätta dit en rem i taget, pust*
egentligen var det tänkt att hon bara skulle rida honom nåra månader o trimma till honom lite så att han kunde åka tillbaka o gå på ridskolan.. men ju mer de tränade o lärde känna varandra desto bättre gick det.. o dom fattade att Harry var en bra ponny
Olivia provade att tävla honom nåra gånger me framgång.. o bara nått år senare hoppade d msv B, vilket är helt otroligt!
o under dessa åren har dom tränat o tränat o tränat så att han ska vänja sej vid att man tar på hans ben o har benskydd mm
för i början kunde han inte ha benskydd/transportskydd/lindor alls!
men nu funkar d med!
Olivia fortsatte att rida harry o hade honom i 3 år, tills hon fyllde 18
men hon som ägde harry tyckte ju inte att harry skulle komma tillbaka till ridskolan, han var en al´deles för bra tävlingsponny för d, o därför bestämde hon sej för att sälja honom
o det var DÄR vi kom in i bilden
Vi såg hans annons på hästnet o fastnade för honom direkt.. så vi ringde o åkte o provade honom
jag red honom 2 ggr o det gick lika bra båda gångerna!
så vi bestämde oss för att köpa honom!
samma dag som min älskade Maja försvann, hämtade vi Harry
så känslorna var otroligt blandade.. varannan minut va rjag glad o varannan grät jag

Harry var underbar o han ÄR underbar<3
o efter vi haft honom i ca 2-3 månader så mejlade vi till hans uppfödare på Irland
vi fick svar o hon skickde även bilder.. tyvärr inga på Harry men vi fick en bild på hans mamma o halvsyskon

ser ni nån likhet? xD
Så det här är alltså Harry söta mamma!

hur som helst, nu när vi har haft honom i ett halvår, så är alla problemen borta..
då menar jag att han kan lyfta hovarna o broddas o snart kan vi nog sko utan lugnande oxå
helt otroligt att från att inte kunna röra benen alls till att kunna broddas o ha transportskydd osv

Harry har nog haft det tufft på Irland, o därför inte velat ta kontakt när han kom..
men nu är han den glada underbara söta goa Harry, Min Harry<3

/Erika

uppe

vaknat-check
kläder-check
frukost-check
taggad-check
gått banan-check
fixat hästen-check
nu kör vi-yepp

wish me luck!

/Erika

jääsp

Drar mej till sängs nu.. galet trött(som vanligt)
laddar inför ännu en dag av tävling o Dröm Msv A..woop woop
taggatagga

/Erika

Dagstorps Derbyt

då vare igång igen.. underbara Dagstorps Derbyt..
o far andra året i rad är jag inte där...suck

så galet härlig tävling! Roliga hinder,grymma skrittvägar,alla kompisar,ryttarfest nr 1.. allt
men iår passa d inte in, tyvärr.. eftersom d är sm om 2 veckor så kände vi att d va lite onödigt att hoppa Msv A derby med typ 25 hinder o 30 språng.. men d är ändå trikigt att missa

senast ja var där va 2009, åkte dit för att jag hade kvalat in me Jacky(eves ponny) till Sveland cup riksfinalen, men vi tog me Drömmis o Jerry med o hoppade lilla derbyt i LA+5..
hade sjukt kul! världens grymmaste ryttarfest, believe me! o såklart, grymmaste hästarna!

Va riktigt nervös inför finalen me Jacky.. i LB+5 xp
men vi nollade faktiskt grunden o gick vidare till omhoppning.. hoppa omhoppningen med ett nedslag o hamnade på en 5 plats, riktigt nöjd med de resultatet om man tänker på hur många som var me från början

men i år så får vi istället heja på min sötastegoastesnyggaste Ella som ska hoppa sin grymma Clifden Hero
in da finale of Sveland cup
GOOD LUCK honey<3


/Erika

Hemma från några timmar på haaaavet!

Och Har bränt mej XD

Men idag vill inte datorn lägga upp några nya bilder.... tydligen.... edast från arikvet...
(dom vi har lagt upp tidigare)


Ni får klara er ändååå!

Fixar't direkt i morn bitti efter att ja sprungit. ;)

Har bara solat o badat idag, liite trög dag, men är hur trött som helst! :O

Och i morse när ja skulle viska på Ozzy att han skulle komma, så orkade han inte XD Så ja fick gå in och BÄRA honom till dörren halvsovandes XD Så gulli e han <3

Tycker att ni ska hålla tummarna för erika i helgen! ------> hon vinner säkert men ändå ;)




//emma'S

lite smått o gott

som jag inte skulle tacka nej till(a)


är det bara jag som tycker att dessa byxor i svart lr rött skinn är galet snygga?

o dessa shortsen, skulle passa grymt bra till en av mina vita "blusar"

vita converse, går till allt o alltid snyggt!

/Erika

Erikas Svar på frågestunden

       
  Heeeej
Ingen fråga men ville bara säga att jag älskar eran blogg!!

Emma: du bloggar AS BRA!
Erika : du är cool

Hej hej!
Ååh tacktacktack va glad jag blir! Jätte härligt o höra! o tack för d, känns bra att nån tycker ja e cool ;)
   
 
Heeeej emma och Erika !
Va föredrar ni?
- guld/silver?
- häst/ponny?
- R,L/peak?
- bajs/kiss? Haha

hejsan!
-vet faktiskt inte.. både guld o silver är fint men i olika sammanhang om du fattar va ja menar..
-hmm.. svår fråga.. Älskar att rida häst eftersom JAG tycker det är lättare..mer likheter i ridningen mellan storhästar en ponnyer, min åsikt..
men ponnytiden varar ju bara tills man är 18.. o d är lixom på ponny som allt händer, alla roliga ryttarefester(såklart fester på storhästtävlingar oxå men inte me samma drag ;) ) Alla kompisar finns på ponny o ja, ponnysar är ju så mysiga! så jag får nog ändå säga PONNY
-R,L
-lite skum fråga..? xd men om du gärna vill veta så kiss
   
       
Gillar ni:
Nellieberntsson.se/Nicholaistyle.blogg.se
isabellaochsara.blogg.se/michelleocholivia.blogg.se
skallerbloggar
facebook
bdb
msn
skype
ormar
spindlar
kaniner
hihi kuliga ´frågor till er båda!

-Ja.. tycker om båda bloggarna, o personerna! :)
-Ja samma här, Isabella tränar ju hos mamma o är en super go tjej som rider grymt bra! o sen så känner ja både Michelle o Olivia bra, riktigt goa tjejer som man alltid har kul me! så jajajajaja till båda bloggarna o personerna
-JAG personligen mår inte dåligt om någon skriver nått om mej eller bloggen på en skvaller blogg.. så för mej är d inte så farligt eftersom jag vet att jag inte tar åt mej.. men annars NONONO för skvallerbloggar!
-facebook är mitt liv.. haha nä men jag hänger rätt mkt inne på FB xd
-njaae
-är aldrig inne på msn.. har glömt mitt lösen.. + att ja inte orkar/har tid att vara inne där..
-har inte skype, men d kommer att ändras innom en snar framtid!
-haha faktiskt så tycker ja inte så illa om ormar..tycker dom kan vara rätt söta xD
fast d kan ju vara läskigt o gå där d kan finnas ormar me hästen lr själv..
-UUUUUUSH!
-kaniner är söta,fina,mysiga men inte min grej att ha kanin
   
     
   Hur blir det med Jarad? Ska elin fortsätta rida han eller är det någon som vill köpa honom än?:)<3

Hon kommer att rida honom tills han blir såld :)
   
   
Hej! Fin blogg!
Jag har en nystartad hästblogg!
Kolla gärna in och kommentera :D

Hej!
Tack så jätte mkt! såklart vi gör!
   
 
Kör lite this or that :)
Storhäst/Ponny
C-ponny/D-ponny
Hoppning/Dressyr
Nellieberntsson.se/Nicholaistyle.blogg.se

Till Erika :D

-samma svar som ovan- Ponny
-Inte så jätte stor skillnad.. men får nog ändå säga C-ponny eftersom man kan rida GP-ponnyn då ;)
-Hoppning! såklart rider jag dressyr oxå o tycker d är jätte roligt me! men om jag ska välja tävlingsgren så är det självklara valet HOPPNING
-Nellieberntsson.se.. gillar att hon är så stark o kämpar så bra me sina hästar.. att hon står imot all skit som kastas hit o dit i denna sjuka bloggvärld.. cred

/Erika

Mobil bloggning à la emma

Another sunny day here in Bohuslän<3 and I love it! Strax åker vi nog ut me båten till kolj ön några timmar för soool o bad! Hunden får stanna hemma tyvärr men kan säga att han är rätt trött så han kan få behöva vila! Haha har ja glömt o berätta att ja är ute o joggar varje morgon ? När mamma, pappa och lillebror sover är ja o hunden ute o springer ;) de tycker jag är lite duktigt faktiskt! Haha. Ha de gott så bloggar ja när vi e tillbaka, för ja menar, de e sommarlov, datorn får lov att vänta då ;) //emma'S

ohoh

I'm in Ale-Jennylund, nåra bloggläsare här?

/Erika


morning

nu bär d av mot Ale-Jennylund för ännu en helg av tävling.. woop woop

Wish me luuck...


/Erika

värk

huvvet värker,benen värker,fötterna värker,armarna värker.. ja hela jag värker helt enkelt o sängen skriker efter mej.. o jag skulle verkligen behöva sova, så det tänker jág göra..
natti natti vi hörs imorgon

/Erika Wenderyd

ett år sedan, sm Årsta Runsten..

Svar, igen ;)

Liselotte om ännu ett svar:
Fuck you! Det e bullshit!
IP: 2.71.140.161
Eemh... vet inte riktigt vad jag ska svara på det? Tror nästan att det är bättre att du skriver hur det var i så fall..?

/Erika

Nu...........

............. är ja trött XD

En heldag i stekande sol kan ta på krafterna!

Hoppas på en lika fin dag i morgon med mycker sol o bad!

Har ju glömt att säga att Ella kommer hit på onsdag nästa vecka :D ska bli suuuper kul!

Tkr att ni ska kolla in denna lilla söta ungens blogg : http://ebbanymann.blogg.se


Ta vara på nuet, och oroa er inte för framtiden.








//emma'S



Ska till Ale Jennylund

På lördag antagligen o kolla ! Mest på Erika för just nu vet ja ingen annan som ska hoppa där ;)

Är någon av er där?
Ska ni hoppa?
Alltid kul o träffa nya personer :D





//emma'S

hjälp d hjälplösa..(?)

elin wessberg<3 om Erika-beridaren:
Jag är där hela helgen så säg till om du behöver hjälp för då finns jag där :D <333
IP: 79.138.191.115
okej, tack så jättejätte mycket! :D

/Erika

Inte OK....

Inte okej asså, Jag e brúnare på ena sidan av kroppen än den andra XD


Blir väl till att jämna ut de i morn ;)

O Svaren på frågestunden kommer snart!


Keep it up babes!




//emma'S


The Sun Is Shining






//emma'S

YES!

Datorn funkade igen! har igentliigen inte så mkt att berätta, händer inte jätte mklt.
Solar o badar o busar me vovven. De e typ de XD

Så tänkte ta o lägga upp mssa bilder nu då!






Typ Perfekt?




Bjuda på sej själv , vare va? --------> GLAD TJEJ








BUSE!





Söt Som Socker, <3



Ja lite blder blev det, på dom absolut finaste i världen!




//emma'S



hagen ridning, underbart

Kom in från stallet för en stund sen.. eller ja ganska längesen xd
red Carro en stund i stora gräshagen, såå härligt o såå varmt! helt sjukt varmt idag! :o
men noo hottie kan stoppa mej från att rida.. haha xD
så jag galopptränade lite o efter halva passet bytte jag o pappa häst så att jag red Conny en stund oxå
haha lite ostyrbar men annars gick det bra med honom oxå...

Red ut med Drömmis i skogen tillsammans med pappa efter d..i klänning-myys
tror att drömmis tyckte d var rätt härligt att komma ut o bara skritta o ta d lugnt i skogen
<3
o min katt, asså han är ju helt underbar..xD
När vi kommer skrittande på gräsgången till skogen så är d ganska högt gräs så jag ser inte att han ligger där..
o plötsligt stannar drömmis till, o jag driver på honom men han vägrar gå, o då tittar ja ner o ser att zorro ligger 10 cm från drömmis.. ojoj
o han flyttar sej inte!
så jag får sitta av o försöker putta bort honom, men han bara ligegr kvar o stirrar på mej.. haha han är för go asså xD
jag böjer mej ner o lyfter upp honom, o han är egentligen sån att han blir sur o hatar när man bär honom
men denna gången bara va han lealös o helt slapp, o när jag släpper ner honom så bara ramlar han ner på sidan o somnar om o slickar pälsen xD
o efter ca 25 minuter när vi kommer tillbaka, va tror ni händer? hela saken upprepar sej igen
hahahah han är bara för söt när han är såhär! ;)

Zorro bloggar ;)
/Erika

oooops i did it again

inte ute än, ooops
så nu sticker ja ut, hörs later on!

/Erika den otroligt långsama!

morgon o massa fix

ojojoj kl. är ju redan 10, oops tänkte ja skulle vara ute i stalelt o rida vid den här tiden..
men d verkar helt klart som att jag har försovit mej..(again)
men aja jag är ju uppe nu iaf så, no problemas eller?
ska käka lite frukost nu, sen sticker ja ut i stallet o rider 4 hästar.. så att mina ben får sej ännu en omgång xd
dagen e lång.. massa å göra.. o dagens schema ser ut såhär

*Frukost
*Rida 2 hästar
*packa täcken o schabrak
*packa min väska
*packa sadelskåp + putsa
*packa foder o hinkar mm
*mocka
*städa lite i lastbilen
*packa in allting i lastbilen
*rida två hästar till
*tror att det är natt nu?

oo till hjälp(ikväll) har jag min aldeles egna syster Evelina.. woop
så d är bäst at jag sätter igång nu.. bay

/Erika

sleep tight honey

drar mej till sängs nu..ridit klart alla hästar o fixat lite i stallet..
mina ben är som spagetti, haha xd
ganka tråkigt inlägg men aja, ni klarar er väl va?

/Erika

ännu ett svar

liselotte om massa nytt:
vrf köpte du inte han gerry? gilla du inte han eller?
Hej hej Liselotte!
Jo jag tyckte jätte mycket om Gerry! Han är en jätte fin ponny, verkligen!men det var så att det var en annan som hann köpa han o så... sen efter d så hittade vi ju Harry o Kakan<3

/Erika

To you paulina

Paulina ;) om Min sötaste Harald:
jjag köpte de i varberg men dom suger märker ju ingen skillnad på kicki o mackan ! :(
IP: 77.219.194.45
Asså d blir inte nån direkt skillnad på hur hästarna ser ut.. utan d är så att magic brush drar upp smutts från djupet o kommer lixom åt lite bättre.. o hästarna ääälskar den! Tycker själv inte d blir skillnad på hästarnas utseende men den är väldigt bra att ta bort lerfläckar o svett med! tycker personligen att den är grym!

/Erika

Min sötaste Harald

Harry ääälskar den nya magic brush borsten, mmmmmh
titta va gulligt han håller på me mulen xD


/Erika

Erika-beridaren

ridaridaridaridaridaridaridaridaridarida<----- min dag
haha nä men idag rider ja 5 hästar.. pust*
blev till att rida Linns häst Cotten oxå.. riktigt roligt faktiskt att få prova lite olika hästar :)
drog bara in en snabbis o blogga lite, sen sticker ja ut o rider lite till.. såklart

dagens hästschema
*Harry hoppa-check
*Carro hoppa-check
*Cotten markarbete-check
*Khairo dressyr-
*Drömmis skogen-

som ni ser, tre klara två kvar.. så min kväll är säkrad
efter sista hästen går ja in o packar inför Ale-Jennylund, bara mina saker idag.. hästarna fixar ja imorgon
vi åker tidigt på fredag morgon,tävlar fre-sön.. Eve åker me på fredag o hjälper mej eftersom mamma är gipsad o inte kan göra nått...därimot vet ja inte riktigt hur jag ska göra me lördag-söndag hjälp men ja har en liten plan så d ska nog ordna sej..;)

tar me mej alla tre killarna till Ale-J. som d ser ut i nuläget iaf..
Harry går LB-LA, Khairo går LA-Msv B o Drömmis går LA-Msv A
så allt mellan 1 m till 1.20
härlig men slitsam helg,yepp

vad ska NI göra i helgen?
/Erika


Carolyn hoppträning


ni vet va ni ska göra xd

/Erika

wiihoo

Säger inte hur d gick me carro idag.. d får ni se på filmen xd

DAGENS OUTFIT

*Skjorta:Gant
*ridbyxor:Kingsland
*Skärp:Brunt swarovski
*Ridstrumpor:Kingsland

filmen e påväg upp, håll utskik!

/Erika

omg

har jag sagt att du är underbar?

/Erika

I soolen

Sitter i stugan i stekhet sol! Så skönt men Gud va svettigt!!! :O går nog o badar strax... //emma'S

ooooh doon't be a....


min aabsoluta favvo låt just nu... mmh kan lyssna på den hur länge som helst, om o om o om igen,haha xd
/Erika

zzZzzzzZZzz

morgontrött erika, japp
vaknade för en liten stund sen.. käkat lite frukost nu o försöker att vakna lite
ska dra ut i stallet direkt nu på morgonen, hoppa Harry o Carro.. sen börja packa lite inför Ale-jennylund..wiiie
känner att d är väldigt mycket pågång nu.. tävlingar,mammas fot,4-5 hästar varje dag.. tjaa, d tar sin tid!

soo my day is fullbokad me stalljobb... mocka,rida 4-5 hästar,packa,vattna,småfix osv
no time for rest, yepp nu kör vi

/Erika


sista inför natten då

Nu-Blogga klart..
efter d-fika me te o hallon (a) yammi
sen-duscha
efter duschen-soooova

wiihoo min otroligt intressanta kväll..yeah

natti<3

/Erika

massa nytt

Har galet många ovisade bilder.. så kände att ja lika gärna kunde ladda upp nåra..

söta emma o Conny innan jag kände henne<3

jag o Dröm för ett år sen<3

söt bild på snuttis berry<3 grrr...

underbara klassen innan vi skildes åt.. haha

Jag o Gerry<3

Dream boy...<3

Msv B finalen i Strömstad -10.. Kom 2:a, ser ni vem som står på tredje platsen? Gämte drömmis? yepp.. Cooper :D <3

/Erika

mmmh..

äntligen klar me allt,.. pust*
vart me Eve hela dagen... fixat lite hinder,mockat(wiiie)ridit Harry o Carro o lite små fix
tog sin tid ska ni veta xd...
hästarna gick bra.. Harry red jag dressyr/markarbete i PD, gick fint i form o hade en bra galopp.. va vääldigt stel dock men d arbetade jag igenom.. så tillslut var han mjuk o bra!
Carro red jag i ridhuset nu på kvällen tsm me Eve.. som red Cornelis xD 1.74 storhäst.. Eve är 1.58, så ja hon va liten!
men d gick bra. hon var lite smått okoncentrerad i början men skärpe till sej efter en stund, min lilla flicka.. eller ah. lilla o lilla ;)

tänkte ta o fixa lite gott att myysa me nu, väldigt sugen på nått smaskigt xd
inte glass eller så, d är inte min grejj som ni vet.. utan.. kan ni gissa?
dododododo
HALLOON! Haha yammi

va har ni gjort idag?

P.S glöm inte d HÄR!

/Erika

Sista inlägget för dagen...

Nu är det ngt som det pratas ganska mycket om just nu..
Nåt som jag verkligen inte tycker om..¨
Nåt som jag inte kan förstå...

Detta med att folk skickar ELAKA kommentarer.
Alltså, knock it off? Skaffa er ett GLATT liv?

Har man inget bättre föör sej än att trycka ner andra?!
Har man tänkt på att denna personen man skriver till kanske redan har dåligt självförtroende?
O att ni slänger in en kommentar som kan trycka ner det ännu mer,... är INTE OK.
Detta kan sitta i FLERA ÅR. Kanske skriva till ngn att "du är förstor för din ponny", den personen kanske ALDRIG glömmer de o frågar varje gång hon/han sitter på sin ponny : " är jag för stor?"
När den personen inte är det!
Alltså detta är inte OK!

Eller att man inte kan GLÄDJAS åt andras framgång?! Va e de för skit då?
Ja menar, visst man kanske kan bli avundsjuk men att skriva sådant till folk?
Jag LOVAR att dom personerna har slitit för att få sin framgång.

För i slutändan kämpar väl vi ALLA för samma grej , elr?
Att bli bättre på de vi gör, få mer framgång, o bli ännuuu bättre!
Man vill UTVECKLAS.

& Folk måste lära sej en sak, en grej jag upplever & ser VÄLDIGT ofta.
Släppa in nya människor i era 'grupper'.
Är det sååå jobbigt att lära känna nya människor?
Inte bara strunta att en man känner har med sej en kompis som man själv inte känner , o i alla fall fråga vad hon/han heter! Inte låta folk stå bakom en annan o inte bry sej! Ta ett steg åt sidan, o släpp fram den personen.

Med detta vill jag ha sagt att frys inte ute folk. Släpp in dom, vem vet, de kanske blir en av dina närmsta vänner?
Va inte så egoistisk o rädd för att prata med personer du inte känner.


Detta är inte riktat mot ngn speciell, utan bara i allmänhet.


Så tänk er för i fortsättningen :)


Eller tkr ni att jag är helt ute o cyklar?



//emma'S

internet ryckte upp sej!

Yes! internet tog förnuftet till fånga! HAHA XD
Men tyvärr går det tydligen bara att ladda upp en bild...hm....
Aja bättre än inget, Right?






OMG! Jag dööööör för bilder, hur mkt finare får man bli?!

Du är det bästa som hänt mej, det kommer vara du&jag tills den dagen då vi inte längre andas.





Du är PERFEKTION.



//emma'S

interneeet @@@@


Bilderna går inte att ladda upp.

Så fixar det i morn ist! de lovar jag..blev lite sur nu....

Men så fort ja vaknar sätter jag mig vid datorn!

Ha en fortsatt as bra kväll, så höres vi later on !


//emma'S

hej alla söta

Jag ber hemskt mycket om ursäkt för att jag har uppdaterat väldigt dåligt, men är i stugan just nu! O jag har försökt att starta det här 4 ggr! XD de funkade inte , men nusåå.

Kan säga att jag har haft en ur mysig dag i smögen på bryggorna....me familj....o vovvsi....
käka räk macka.. o mjuk glass, (vilket Ozzy även fick smaka på min för ja orka inte allt XD)

sitter här i soffan o kolllar på simpson...haha..

Bilder på Glass-ätande Ozzy Och Cooper kommer snart!


//emma'S

såklart, va annars lixom?

I'm in da stable, va annars lixom? xd
ska mocka lite,fixa lite hinder o rida
Eve är here som hjälp....
som ni fattar blev Kungsbacka inställt, men aja d blir bra såhär me

/Erika

ser lite random ut här, I Know..

kommer ni ihåg..?

Det HÄR ?

/Emma o Erika

lite grejjer ni..

....inte visste..eller?

*Jag är väldigt intresserad i mode.. älskar alla program om mode,modeller,disign.. samma me tidningar

*jag älskar att fota.. men har inte jätte mycket tid över till d..

*Min storhäst Carolyn är undan mammas förra storhäst Gavotte som har gått 1.50 hoppning, o efter Cardento

*jag älskaarr hallon! ALLTID lika gott!

*jag läser väldigt många bloggar varje dag..

*jag skulle vilja prova att färga mitt hår eller slinga.. men jag vill inte förlora min naturliga hårfärg..

*just nu tänker ja så mycket att mitt huvve värker xD

*jag saknar godisätandet.. skulle gärna äta men tycker d är SJUKT äckligt!

*Jag lyssnar inte särskilt mycket  på musik.. eller jo när jag är i stallet eller målar o så

*Jag är otroligt pratglad,aktiv,o frammåt.. ibland lite för mycket xd

/Erika

ooohhoh

Hittade lite grejjer från Jofama by kenza som ja bara är in loove with



va tycker ni om dessa(galet snygga) saker?
/Erika


schemat idag..

*Vakna
*äta frulle- min bror har BAKAT bröd?:o
*Chilla lite vid tvn
*gå ut i stallet o rida lite..
*kanske dra t kungsbacka för liite shoppning xd
*komma hem o rida lite till
*sen blire bara en chill kväll

riktigt slapp dag ändå.. galet härligt!
behöver sånna här dagar ibland.. efter alla sena kvällar,tidiga mornar o tävlingar..

hur ser eran dag ut?
/Erika

lite om dagen...

gick upp runt 10.. blogga lite, åt lite o var allmänt trög
rätt skönt att vara det ibland..
Inez kom 11.30, stanna tills 20.45
hade en grym dag med den sötaste<3
skrittade Khairo när hon skrittade Dröm , spela lite fotboll(wiiho) o såklart..
STEKTE PANNKAKOR... som såklart blev helt fel,bräna,trasiga o slutade i en stor svart hög
men, va gör d när dom smakade okey?xd

red Harry vid 21.45, skrittade o travade mest.. försökte att mjuka upp honom lite i sidorna o så..
sen satt jag på Conny en liten stund bara o skritta o trava.. ska ju sättas igång nu

nu väntar te, dusch o säng

natti<3
/Erika

igen, yepp

kände för att göra en sån här igen..så nu kör vi en FRÅGESTUND

Fråga vad ni vill om vad som helst.. vi svarar 100% ärligt!

/Erika o Emma

I stugan!!!

Sitter i stugan nu o kollar tv, så i morn skaka blogga massor, som kommer upp de närmaste dagarna. Här kommer jag stanna till fredag nästa vecka ;) saknar ponnyn massa redan men han har ett välförkänt sommarlov just nu! O som tröst har ja min överfina vovve med mig<3 o världens bästa ELLA OLSSON BROANDER kommer hit nästa vecka några dagar, så Najs! Ha de så länge! /emma

Jerry o Elin, Varberg


Japp som vanligt, sätt på låten o starta sedan filmen.. im not so good att sånt där xd

/Erika

Vi sänder en tanke<3

till våra grannar i Norge..
som har varit med om nått så hämskt att det inte finns ord... nått som aldrig kommer läka
nått som ingen trodde kunde hända..
men det gjorde det
 tänk hur mycket EN ända människa kan förstöra..
EN
o hur många finns det runt om oss som skulle kunna göra samma sak?

It's a really sick world vi lever i
så håll ihop, håll i era nära o kära

o sänd en tanke..
/Erika



min stackars mamma...

hänt en otroligt tråkig sak med min mamma...
nått som man inte trodde kunde hända...
hon har brutit foten..hm.. tänker väl ni.. d är väl ganska vanligt?
jo, men.. det var ingen vanlig olycka som hände

vi kom fram till Varberg, solen sken allt va på topp..men
när mamma ska gå ur lastbilen snubblar hon, faller rakt ur o landar så snett med foten så att den bryts!
så innan vi äns hunnit lasta ur hästarna så var allt förstört!
hon fick tillbringa hela helgen i varberg i lastbilen eller på en stol vid banan..
tycker så galet synd om henne

nu återstår 5 veckor med gips o kryckor..

<3

/Erika

10.35 monday morning

yääpp... i'm up
o ja, jag är lite sådär halv seg...

ska ta o fixa lite frukost.. sen får la ja ta o "städa" lite på mitt rum antar ja.. nu när jag får fin besök..xd
Inez kommer runt halv tolv.. stannar tills ikväll nån gång,så ja kommer inte ha världens bästa update idag..
men såklart så kommer ju d fixas me

idag ska alla ridas.. Dröm i Kakan ska skritta.. tänkte att Inez skulle hjälpa mej me d.. fast d vet hon inte än..ops xD
Rider Harry o Carro ikväll... ah, det blir bra

rolig,lång,knäpp dag med underbaraste- here we come

/Erika


restaurang Erika

är nu stäng.. sista måltiden är serverad..
känner mej rätt duktig ändå xd, är inte särskilt bra på att laga mat, d kan ja ju inte säga.. men nu är det faktiskt så att jag gjorde middagen o efterrätten..
verkar som att d var en ganska lyckad insatts iaf.. tur d ;)

känner att jag börjar bli väldigt trött..
ganska sliten efter 5 dagars tävling.. FEM dagar
ojoj'
ska bli riktigt härligt att sova i sin egen mjuka kalla säng o bara sova ut.. grr
men INNAN d blire dushen, rätt skönt d me

imån nån gång på dagen kommer Inez, blir riktigt nice..
ingen aning när hon kommer lr när hon går.. d återstår att se.. haha xd

go'natt ni, hörs imån

/Erika Wenderyd

Hahaha,this made my day

Asså fy fasen, jag sitter här o skrattar för mej själv xD för hur kan man låte bli?

checka detta----> http://nicholaistyle.blogg.se/2011/july/jag-blir-utmanad-av-er.html

ooh myy xd

/Erika

hemme efter grym helg...

o såklart kmr d lite resultat här:
evelina o harry: CR LC uppvärmning 0 fel, LC kval I 0/0fel o 5:a,Kval II LB 0/0 fel 2:a,ledde inför finalen men valde att inte hoppa den... eftersom hon aldrig hoppat bana på 1 m innan-grymma, riktigt stolt!

Elin o jarad: LB kval I 0/4 fel, skit pet på första i omhoppningen,LA kval II 0/8 fel grymma men fick två ner på d sista två omhoppningshindren, gick till  A-final o debuterade LA+5 mett ner i grunden, så jäkla duktiga

o tills sist
Erika o Khairo: LA, d SÄM STA underlaget jag NÅGONSIN ridit på... gräs/lera/1 m djup sand/klister
halt som tusan! nollade runden o rev ett i omh. men kom 3:a ändå :D
LA idag 0 grunden o rev sista i omh.... -.- bara otur
Msv B RPC, helt amazing ponny asså! fick två skit pet för att vi kom lite nära.. annars underbar3

Erika o Drömmis: LA, ja som sagt.. underlaget va la inte dbästa precis.. men nolla grunden o fyra fel i omh. pga  att ja fick en fluga i ögat xd
Msv B idag, RPC.. super fin, bra jämn runda o allt men fick två skit pet me han med.. sånt som händer.. fick inte riktigt tillbaka honom så kom lite nära

galet ´stolt över eve o harry o elin o jarad som va sååå suktiga i debuten!


tack alla för en grym helg/vecka..
Joy,cornelia,eve,elin,ella,therese,maja,amanda,Kayla,alexandra,emma oo MÅÅÅÅNGA mer!

haft rymma dagar, me galet mkt skratt,pinsamt,roligt,regn,sol,värme,blåst

saknar alla redan....

 


/erika


I loooooove

detta kortet, , vet inte varför, men den e bara så cool!
Hela bilden lyser självförtroende o ACTION!

Han e så grymt fin!




//emma'S

Bilder , Varberg

 --> omhoppning, kval 1




 

ÄLSKAR DENNA BILDEN OVANFÖR, HAN ÄR SÅ SNYGG!
Synd bara att tygeln åker upp i ansiktet på mej bara xD

 

åh miin otroligt duktiga ponny!
Är så sjukt nöjd med HONOM i helgen, så tråkit att ja va sjuk bara.
Men nu taggar vi nästa tävling ist, om 2 veckor!
Tack för detta meeting cooper, du är guld värd<3

Home sweet home

Är så nöjd med ponnyn! Tyvärr fick jag feber o mådde piss till kval 2, så ja åkte häst..
Men min gudomligt snälla ponny hoppar ändå, dock med pet, för ja orka inte hålla ihop honom.
Men han va så snäll!
O tack vare min 3:e plats i kval 1, gick jag till A-final!

Så startade den, även med hög feber. Men kämpade så jag dog denna dagen tyvärr med ett stopp, men jag såg inget som helst avstånd!! Så jag tryckte av han alldeles förtidigt, så han blir tvungen o stanna, o blir arg på mej för jag pajade ju för honom, xD så han vänder o springer o lufthoppar! XD resten av banan felfri ;) 
Är tacksam för att han är så KLOK, hade han försökt att hoppa, så hade vi kraschat mitt i hindret.  
Så 4 fel o precis utanför placering, men han har ju varit perfekt hela helgen!<3
Synd bara att ja va sjuk :(

10:à totalt av alla c ponnys i min cup, trots feber, inte så dåligt va? ;)

Bildbomb kommer strax!

//emma'S





Min fina, MIN fina.


hem igen..:'(

Kommer hem idag... tyvärr
haha ne men hart haft d grymt härligt här i Varberg så d känns lite ledsamt att åka hem faktiskt..
träffat massa nytt folk.. grymma människor o gamla friends<3
tack alla för denna underbara helgen/veckan

bloggar mer när jag kommer hem, för nu.. nu ska jag rida

/Erika

idag gäller d då

ridsport ponny cup, woop woop

min finaste underbaraste Cornelia<3 här tillsammans me B-ponnyn Fridolf

Harry Vingåker


/Erika

night is falling

nattinatti, dream sweet dreams

hörs imån<3
/Erika


stallet, såklart

drar mej t stallet nu.. ska ta o putsa o skritta ut mina finaste killar<3
hoppas o tror att det gick bra idag...xd
Eve,Lotta o Harry har åkt hem, efter en grym helg..(förhoppningsvis)
Lotta o eve kmr tbax imorgon igen o tittar på ridsport ponny cup klassen
helt galet roligt har vi d här i Varberg!
alla,alla,alla d bästa är här.. nåra har ju åkt hem idag, saknar dom redan...

ryttarfesten igår va grym, btw
skrattade heela kvällen o hade d awsome!
tack alla för en riktigt lyckad vecka

/Erika

dream Boy LA Vingåker


va tycker ni? komentera gärna...
/Erika

time for me

då vare dax för mej...

/Erika

dagen dåå

Eve hoppar B-final me Harry(bestämt innan), LC+5
ja hjälper såklart
Elin hoppar B- lr A-final(svårt o veta innan) LB+5 lr debut LA+5
hjälper dom me ofc
mina små pållar kommer runt 2 tiden tror ja.. min klass börjar 15.30
hoppar LA o Msv B me båda, imån blire ridsport ponny cup
så dubbel nrevositet idag,puh
andra msv me Khairo,stor gräsbana..iiiiiiih
tror d ändå d kommer gå bra, när ja väl sitter där uppe på hans rygg känns d som att inget kan gå fel
min kaka<3

/Erika

Ska hoppa om en stund!

Ska hoppa snart antar jag!
Håll tummarna, skriver resultat sen!



världens finaste, oavsett vad.




//emma'S

please svara

bloggtävling/inte bloggtävling..
vad tycker ni?

/Erika o Emma

saturday morning

uppe-check
frukost-påväg
kläder-på
håret-åt alla håll
nervositet-bring it on
taggad-inför en grymme dag me alla bästa o ja, ja ska faktiskt tävla idag ja me..!


/Erika(the girl with the mördande ögonen)

Nån typ av svar...

Fick en fråga om vilken höjd jag skulle vara med o tävla i här i Varberg..... Jo jag kommer att hoppa LA-msv b vilket motsvarar 1.10-1.20 m :) /Erika

godnatt

7kt trött efter långa kvällar/nätter o tidiga mornar.. så nu drar ja mej
sleep tight babes

/Erika


hemma står mina finaste<3

... mamma Lena fixar så att Dröm o Khairo  får trimmas lite inför tävlingen imån..
sen så fixar hon packningen oxå o  alla saker inför imån , så att ja ska hinna o så att d flyter
thanks<3
har d riktigt bra i varberg asså!
solen skiner(hoppas ja) o alla grymmaste ponnybrudarna är här, kan d bli bättre?

/Erika

Eve o Maja på förra årets varbergshopp... skanar dej gumman<3

....


Chillar i Varberg, nåra bloggläsare här?
/Erika

broddar deluxe

glömde säga att ja fick nya broddar av över söta Cornelia i Uddevalla
en ny grej som vi ska testa
broddar som är färgade, i samma material som jin så dom e hyper lätta
riktigt coola faktiskt

/Erika

Min ponny e gryyyyyyyyyymmmm

And I love him <3







//emma's

eves resa genom luften,yepp


mycket snyggt Eve, en klar 10:a!

/Erika

Gårdagens

Tja! Tänkte att ni var lite sugna på resultatet.... Harry o Eve LC förklass, super fin runda som slutade på 0 fel, kval I LC ännu finare runda, bra jämn galopp,perfekta avsprång o allt! 0 fel även här o 5 av 43 starter! Jerry o Elin LB kval I, super runda på väldigt taggad häst! Tyvärr så blev d ett ner i omhoppningen för att han tog av väldigt stort.... O väderprognosen för varbergshoppet 2011 är: REGNREGNREGN! Wiiiihooooo, mmh ja.... /Erika

upp o hoppa ligg inte o dra dej.. lr gå den så?

drar mej upp ur sängen nu..
ny dag nya möjligheter.... idag blire LB för Eve o Harry, yeey
good luck bruden
kommer såklart finnas där o hjälpa henne..
Elin hoppar Jerry i LA, går d till A-final blire LA+5 imorgon
go girl, o jerry då
tror nästan ja är mest nervös av alla
ushh..
önska dom lycka till,så hörs vi senare

/Erika

Elin o Jerry står för bilden, grymmisar<3

natt<3

drar mej upp på hyllan nu...
behöver min skönhetssömn ju... ;)
dagen har vart grym
hästarna har skötts sej perfa(hoppas ja)
resultat kommer upp såfort d har ridit.. för d är ju lite svårt att veta sånt i förväg ;)
nu taggar vi en ny grymme dag me alla d bästa
natti<3
/Erika

syster yster

Den HÄR tjejen är speciell
hon är inte vilken tjej som helst... vi är som systar...
i 2 år har vi kännt varandra, på 2 år har vi kommit så nära varandra som familjemedlemar
vi vet allt om varandra, vi kan snacka om allt,berätta om våra tankar som ingen annan har fått veta
vi har våra stunder, ibland kan vi bli arga på varandra.. men syskon hänger ihop ändå
vi vet var vi har varandra o älskar varandra precis som vi är¨
inget kan någonsin skilja oss ifrån varandra, min älskade syster

Evelina Zetterström sandén<3

/Erika


Yey!!!:D

Cooper va helt fantastisk idag!!!:D uppvärmingsklassen kändes bra, men fick ett Pet de blev lite tokigt ! O i kval 1 nu så kom ja 3:a!!!:D haha o idag hade ja bestämt mej för o ta as snäva svängar! O de gjorde ja såklart ;) han va UNDERBAR idag. ALLLT stämde. Fina ponii<3 o nu sitter ja i husvagnen , själv dock. Mamma skulle åka o handla lite, så ja går nog o letar efter Erika o Eve eller Ella snart. Men de regnar ute :O de e inte kul!!! Hör av mej senare!! //emma'S

nu

..stallet
göra där: Fixa hästar,putsa,borsta,skritta
efter det:fodra
sen:äta
efter maten: chilla me alla godingar som är här
ikväll:sova

/Erika


bilderna som aldrig kom

skulle ju ladda upp lite GP-ponny bilder i samband me d inlägget, men d funka inte..
såå häär kommer dom!

minnet för livet<3







/Erika


saknad

saknar er sjukt mycket
tänker på er varje dag, hur fina ni är o var
ni var underbara, d finaste
jag älskar er galet mycket o kommer alltid att göra

mina änglar<3

morning<3

uppe-yepp yepp
nu blire frukost o sen ut till banan
Eve hoppar lille Harry i förklassen LC,heja heja
håll tummarna för dom!
sen blire LC första kvalet
Elin o Jerry hoppar första klassen LB kval 1, ska hjälpa till lite där me
känns lite skumt att inte ha nån egen häst o tävla men, faktiskt, rätt skönt
blir ändå min tur på lördag ;)

banan e riktigt fin, som alltid
fina hinder o så me!
så nu kör vi helt enkelt, lr aa.. ni?dom kanske man säger?
aja, let´s gooo
/Erika

natti

drar mej t sängs, imån blire tävling för Eves del..
skönt att hon har D-ponny så man kan sova lite ;)
Ska hjälpa Elin me jerry oxå, googoo
längtar
ska bli sjukligt roligt d här, gaah

är nån av ER här? Kom fram o snacka vetja!
/Erika

ibland fattar man bara inte...

hur orkar folk? va är meningen? vad får ni ut av d? mår ni bättre? mår andra bättre?

om inte, låt bli!

/Erika

I bilen på väg till.....

....VARBERG! o kan säga att cooper brukar ju alltid krångla vid lastning, men idag för fäders gången gick han på med en gång! Åh så glada vi var:) tack vare Eva som hjälpte oss o "läxa" upp cooper lite i Skåne XD Han e nytvättad o longerad idag! :) //emma'S

in VARBERG

.. som rubriken lyder..
we are in varberg nu!
har precis ställt in hästarna i boxarna, ska ta o fixa lite me boxgardiner o lite sånt
ska ta ut o rida dom sen me, lr aa.. Eve rider båda sen så skrittar vi ut tillsammas ikväll
fått till en riktigt bra plats till lastbilen me, yeeey
kommer massa trevligt folk, o då menar ja MASSA
kommer bli en riktig grymme vecka!

är nån av ER här?
/Erika

ja, precis.. ja kan stå lutande

fly like a bird...

..eller ta lastbilen
yepp, sitter i lastbilen påväg t varberg, kommer bli en galet rolig Vecka
är taggad som tusan!
Eve tävlar Harry torsdag t lördag..Lc,Lc,Lb,Lc+5
ja bor me i lastbilen, mamma kommer upp  me Khairo o Drömmis på lördag
sen hopapr ja La-Msv B.. ridsport ponny cup me båda
andra msv B me khairo, puh

/Erika

förra årets varbergshopp, med världens finaste B-ponny<3

ja vet ja vet

måste skynda mej I know MEN...
checka staatestiken o, igår... blev det ABSOLUT ett BLOGGREKORD!
galet roligt!
nu gör vi d här tillsammans, vi skriver ni diggar
okay?
/Erika o Emma

försov oss

såklart!
vaknar TVÅ timmar för sent, lyckat!
så nu skyndar vi oss ut i stallet o fixar me allt..
som ni fattar så har ja inte tid till d här egentligen men...
klockan tickar
see yaa later!
/Erika

goodnight bby<3

sleep tight!
sover i gäststugan me Eve inatt, jippie -."

/Erika

tagga tagga, woop woop

allt klart, packat färdigt, hästarna e klara för idag o allt är under control
så sjukligt taggad nu!
hela bästa ponny sverige på plats, kan d bli bättre? nopp tror faktiskt inte d..

Khairo var grymt fin idag, red markarbete i PD
Eve hoppade lite me Harry för att få den sista goa känslan innan tävlingen
gick kanon! hoppade en liten bana på LC-LB höjd, måste säga att hon rider honom mega bra!
riktigt roligt att se asså!

så imån bär d av vid 13.00-14.00, fixar lite o så där, eve rider harry på plats
men innan vi rullar här ifrån så ska Dröm,Carro o Khairo ridas.. o Jerry
upp tidigt, yepp

as usual

/Erika

ELLA = SNART!

SNART FÅR JA TRÄFFA MIN ENORMT SAKNADE ELLA OLSSON BROANDER!

sjukt underbara söta person.

ni hittar henne här! 

Vi har redan kommit överrens om att sitta o tjocka oss i godis i husvagnen som ja o mamma har!

Gaaah, sakna henne..

Är otroligt glad att ja lärt känna denna tösen.

du ska veta att du är värd allt gott på denna jord. du o clifden e grymma, DU är grymm, glöm aldrig det tjejen.

puss på dej <3


//emma'S

svar, eller nått sånt

Smsa Låna  (evelina@live.se) om på g asså:
Bra sida du har! Jag har läst igenom några av dina andra blogginlägg och jag diggar vad jag ser :D.
IP: 204.45.44.233
Matilda om Hemma....igen....:
Jag vill önska dig en bra start på en ny vecka! :)
IP: 78.69.143.39
19 Juli, 22:24  
NellieB  (nellieberntsson@hotmail.com) om Hemma....igen....:
Lycka till i Varberg!!!
Tagga, tagga, tagga.
IP: 81.227.5.55
19 Juli, 22:11  
Malin om Hemma....igen....:
vilken fin header , gillar eran blogg :d
IP: 85.226.37.61
*Tack så jätte mycket! riktigt roligt o höra! får en att tagga ännu mer o vilja blogga!tack igen
*Tack, detsamma :)
*Tack, detsamma! grymt láddad!
*Tack jätte roligt att höra!
/Vi

Hemma....igen....

Vart i stallet hur mkt som helst idag...precis tagit in ponnysarna...putsat ännu mer.....packat ännu mer....
Handlat MÄNGDER av mat, o godis ;)
Vi ska käka med mysiga familjen Nymann i Varberg!


Kan säga att rida idag gick OK. Han va uuuuur fin i trav o skritt, men i galoppen va han suuper konstg, typ helt hård o stel i nacken, o lite 'spruttig' XD
Men då ravade ja en stund o tog en till galopp o då vart han jätte fin :)
Så I morgon tror jag att jag longerar honom en bra stund, och sedan TVÄTTA honom, då han ser ut totalt som en sketen gris XD 
O efter det ta en promenad så han torkar.

Vi lastar väll vid 3 tiden cirka, om allt är klart då.



Är så himla taggad nu kan ja säga....
Sjukt sugen på o tävla!





//emma'S



kan inte fatta

att jag har så galet fina hästar!
Hoppade Drömmis lite i paddocken idag..
linje på 1.10,räcke på 1.25 o kombination på 1.15-120
allt flöt, kom rätt överallt,han hoppade strålande!
känns super inför helgen!

Eve kom precis, ska fixa hennes ridbyxor o sy lite i dom ;)
sen drar vi ut i stallet,packar klart o rider
full kväll, som vanligt

/Erika

ute?

nopp, im still in da house xd
fixar me filmerna, som kommer upp t helgen..
ska dra ut i stallet om 10 min.. drömmis skos nu så ja får ta o rida Carro först
har vart så duktig så att ja har städat mitt rum lite iaf.. ändå lite bra

/Erika


outfit for every day-check

fixat mina kläder nu.. så lite frammåt går d xd
blir så galet slapp ibland asså, men aja va gör d sålänge d löser sej i slutändan?;)
håller på att ladda upp filmer från Vingåker, kommer upp på lördag..
så tro inte att d blir tomt här när vi är borta, tvärtom d blir MASSA update.. på inställda o live bloggning
så d blir nog bra ska ni se..

känner att d börjar dra ihop sej mot luch kanske.. rätt hungrig e jag iaf..
så nu sticker ja, äter o ger hästarna lite o tugga på
sen ut i stallet, rida Carro o dröm o sedan invänta Eve..
yepp, min dag

hur ser eran ut idag?
/Erika

ännu en film,japp

kan inte riktigt få musiken o funka så ni får ta o starta detta klippet me musiken o sen filmen..
men d funkar la bra ändå eller? xD



/Erika

Hemma från lisa"!

Kom precis hem från lisa, vi red en ganska lång o mysig uteritt :)
Prata massa, haha de hände lite roliga saker när ja red Indiana xD Vi skulle hoppa en liten stock, o hon får fnatt o tvärnitar 2 centimeter innan o sen kastar sej över! hhaha vi skratta lite åt de ;) Sen kom de en till liten stock en bra bit längre inpå turen, o både Gentleman o Indiana saktar av så vi får driva o smacka XD hahaha riktiga små busar ;)
Så nu e ja hemma, lunch står på schemat! O packa, packa, packa....
Sen till ponnyn o packa ännu mer, o rida o frisera !

hörs later on !




SÖTNOS



//emma'S

frukost

-check

Earl grey te med sugrör
walnötsbröd
grebbestadsspecial bröd
=yammi breakfast

/Erika


vattentät,jupp

uppe... himla skönt o sova
planen idag är att rida två hästar på dagen.. Eve kommer vid 6, rider Harry o hoppar nåra språng
ja rider en häst me henne
sen så packar vi klart ikväll,putsning o foder e kvar..o min väska(lr väskor blire nog)
ska klämma in ett besök i kungsbacka oxå, blir väl nån gång på dan..
vi åker imån, ja bor me mamma,eve o lotta i lastbilen.. mamma åker hem igen på torsdag o då åker ja me..
rider khairo o dröm hemma sen åker vi tbax t varberg igen o så är ja me resten av dagen..
mamma bor kvar tills fredag, åker hem igen o fixar me mina hästar o min packning..sen kommer hon ner me dröm o Kaka på lördagen,eve hoppar harry o sen kör dom hem honom...lotta o eve kommer ner på söndagen igen o hejar på mej, vattentät plan ;)

får nog ta o käka lite nu...om min grymme plan ska hålla..hörs

/Erika

sm 2009 Ljungby, nolla kval II... minnen<3

jumpi'n kakapony

hoppa lite me kaka, visade jue tt språng för er i förra inlägget
kan bara säga fyfasen vilken ponny ja har!
dock började d inte så bra...xD
sitter upp-check
rider ca 20 m-check
Khairo hoppar rakt upp i luften-check
Khairo bockar-Check
Erika flyger-Check

yepp, så gick d till... efter d släppte vi honom lös i ridhuset så att han fick sprattla av sej lite, gjorde susen kan ja säga!
satt upp igen o red igenom hon lite
hoppa ett litet hinder på volt, räcke på 1.25,oxer på 1.25 o en linje kombination-räcke på 1.15-1.20
galet nöjd me hoppningen, ponnyn är ELIT
helt underbart att sitta på hans rygg, känna vilken power han har
som en dröm

tack khairo, för dagen(förutom avsittningen)¨
/Erika

du är fantastisk bby<3


behövs bara ett språng för att fatta.. du är amazing killen<3

/Erika

back in the sofa

and i'm lovin it!

Vart fullt upp hela dagen....Packat lite, putsat mängder av grejjer....ponnyn har fått nya skor....
Allt e på topp o ja o cooper laddar till varberg!

Och jusst de, FICK MITT SNYGGA SADELSKÅP IDAAAAAG :D wiiiiiie

Ponysarna står inne i natt, o släpps ut i morgon bitti. Sen vid 9 cirka åker ja o mamma till lisa o susanne, där vi rider ut en mysig sväng med dom :) Känner på mej att det blir mycket prat! o de gillas ;)

Får ju även passa på o säga grattis faktiskt till lisa, som VANN LA;n me Gentleman! o sen vann hon LB;n me gentleman igen o kom 2;a me Ulex, Så bra jobbat!

Men nu ska ja käka kvälllsmat.



Bild från AW..SAKNA



//Emma'S

städa står på lista, yepp

sticker ut i stallet nu o städar sadelkammaren
lika roligt som vanligt, men d måste ju göras
o ja får ju hjälp av eve som tur är!

Red drömmis tillsammans med Eve o Elin förut
gick super för mej, bockit för Eve o i 348 km/h för Elin xD

/Erika

om sanningen ska fram

cred till den här tjejen asså
all skit hon får ta, alla som e på henne, alla skvaller bloggar som skriver hejvilt
men hon skiter i d, fortsätter kämpa o låtsas som inget har hänt

själv kan jag inte fatta hur äldre,vuxna o ponnymorsor
kan va på o trycka ner nån som är 11 år? det är ju sjukt
när folk som är flera år äldre hänger ut henne på sin blogg, o skriver taskiga inlägg om hur dålig o omogen hon är
whaaat?
hon är ju för 17 väldigt mogen för sin ålder
stå på dej, personerna i din omgivning är bara avundsjuka

kan störa mej så otroligt på nått sånt här, inte bara i hennes fall utan att d finns många som håller på såhär
när VUXNA människor är på en liten tjej/kille
när såkallade "förebilder" hänger ut folk
d behöver inte skriva namn, man fattar ändå
alla taskiga komentarer som skickas
ja men självklart, hur svårt är d att vara tuff bakom en skärm? inte särskilt svårt
ingen, o då menar ja INGEN av d här personerna som skriver sånt här på sin blogg lr komenterar
kommer ALDRIG våga säga d irl!
o varför skulle dom egentligen?
kommer ni må bättre av d?
att komentera hur dålig lr ful någon är kommer ju inte precis göra så att personen utvecklas?

har ju själv hört va vissa kan säga utanför banan..
o mina kompisar har stått gämte o hört vilken skit som kommer ut om mej, o d värsta är.. oftast är den ALDRIG SANN

istället kan ni väl peppa,uppmuntra o stötta
släng iväg en snäll komentar
visst, d är okej att ge tips o råd på filmer,bilder lr i "verkligheten"
men d är en väldigt stor skilnad på att ge råd o att klaga
skriv, oo va fina ni är! men du kan tänka på att vrida om din hand, bara ett litet tips... inget fel i d!
men att skriva: asså du rider honom/henne så dåligt! o dessutom ä rhan/hon alldeles för dålig, sälj vetja!
lr: OJ va stor du är på din ponny!! Det ser ju hämskt ut!
ååååh va mkt gladare man blir!

tänk efter innan ni skriver nått!
ni sårar, o förstör...

mina tankar, mina åsikter

/Erika

Komentera gärna va ni tycker.. har jag rätt?



right nooooow

Tänker: på massa
Är: trött
längar:till Varberg
har på mej: Min "onepiece"
vill:äta
orkar:inte äta

våra tankar,våra känslor,våran blogg

/Erika

just nu

sitter o fixar inlägg inför varberg..
blir nåra stycken ja ja ju säga
tänker som en galning,gaah

funderar på att äta frukost snart..
låter d som en bra idé?
Oftast brukar ja vakna av att ja e sjukt hungrig, men idag så har jag inte känt av d alls.. o klockan e ändå 11.15.. mystiskt....

/Erika

prins Jerry


charmig lr vad?


riktigt....

...chill morgon asså
inte ofta ja sover länge,vaknar o lägger mej i soffan o chillar... inte ofta!
men d behöver ja

Eve kommer runt 2, vi städar sadelkammaren o börjar packa inför varberg..
o rider såklart
ska la ta o hoppa Khairo lite ikväll me, o kanske nåra språng me Drömmis
Carro ska bara markarbetas, o galoppträna lite
efter d, nothing to dooo

/Erika

dags o nana på kudden nu

drar mej t säng, sjukligt trött
filmen va bäst,maten va go o soffan va lika mjuk som vanligt ;)
riktigt chill kväll...

sov gott nu alla<3

/Erika

I have the time of..

Käka lite hos Eve´s place förut.. mumsi
nu går ja ut i stallet o leder Carro..
sen SOVA!
Eller nä, juste.. jag ska se Systrar i jeans som går på 3an kl 21.00.. ja vet kl e 20.54 nu men ja får la missa lite då xD

är helt sjukligt trött efter en jobbig vecka med mycket jobb... o den sjukligt långa dagen igår
gaaah, vill bara sova! o ja lovar d ska jag!
imån blire LÅNG sovmorgon, yepp yepp'

/Erika

Hemma från the stable

Det spö-regnade när ja va i stallet och jag hämtade in lilla cooper som va helt pisse blöt! han fick på sej ett täcke som suger upp vatten, och sen la ja på ett regntäcke o ett schabrak så red ja i ppaddocken :)
Mjukade upp han ordentligt! I början var han rätt stel från gårdagens hopp-pass, men efter en stund blev han suuuuuper fiiin :)
Jag Cooper & Mamma hade rätt kul XD hehe..
Hade tänkt att frisera ponnyn lite idag, men det gick inte för han va ju dyblöt o helt geggig, men jag gö de i morn :)

OCH I MORGON FÅR JAG HEM MITT NYA TÄVLINGS SKÅP!  Börjar packa in lite av sakerna i de oså,

sen ska ja även bara mina söta cupcakes! För nu har jag köpt nya färger :D (jag pyntar dom jämt)
Så vi kan ha med oss till varberg, för att everybody loves emmas cupcakes! ;)




Jag & finaste Conny,<3



//emma

hooome

hemma från Eve igen, grym mat, yammi
nu bär d av ut i stallet, fixa Carro lite..
sen in o förbereda inför varberg.. har ju en del inlägg o göra om man säger så.. är ju borta i 5 dagar
kommer ni klara er? d tror ja..hoppas d
är galet taggad inför varbergsveckan! Eve tävlar Harry tor-lör sen kommer mamma ner me Khairo o Dröm
så hopapr ja lör-sön
yeeeeey
/Erika

yeahyeah

taggad ut i tårna, nu kör VI!

/Erika

Khairo nu, sen Eves...

Drar ut i regnet o rider Khairo nu..
lr inte i regnet utan i ridhuset
sen drar ja t Eve o käkar o chillar lite..
efter d, hem igen o rida/lösgaloppera Carro
yepp, kvällen e fullbokad, me bara grymheter

hur ser eran dag ut?
/Erika

Emma, min fina saknade Emma<3

Förlåt..

Sorry för en as dålig uppdatering, MEN ja mår inte toppen idag, så de blir ingen great update idag heller..
Ska försöka att fixa mer ikväll! Förhoppningsvis llite piggare då.



Bilden e från kanske andra dagen tsm,





//emma's

d regnar ju ute ;o

Kom hem för en stund sen.. Var i Landvetter o galopptränade Drömmis på Gustafssons travbana...
o d ända jag kan säga är: Dream Boy, alla ryttares dröm<3
Han är helt fantastisk

Skrittade fram ett varv,sen travade vi ett o därefter ett varv i galopp
sen så skrittade vi ett till, o sen galopp.. efter d gjorde vi likadant en gång o sen trava jag av o sedan skritt
han va alldeles lagom pigg
bra jobbgalopp,han va mjuk,bra i form o allt stämde
MEN
han var(såklart) Dream mes nr 1! Haha han är för söt min lilla prins
kommer i en bra galopp,han bjuder o jag bara står i lättsits
DÅ, ser han de förskräckliga BLÅ TUNNORNA!
TVÄRNIT,o lite stuts
haha så söt, lika rädd VARJE varv xD

ska åka dit nån mer dag nästa vecka, o typ 2 ggr i veckan fram tills Sm
han ska ha superkondis på sm så att han orkar alla långa banor

Dream Boy<3

/Erika

Iväg igen

Påväg till Landvetter o familjen Gustafsson.. Galoppträning vare ja... Woop woop.. Hörs later on

...

...sorry, men vem är d egentligen som ska....?

/Erika

omg....

Ojojoj äntligen hemma!
efter en (alldeles) för lång dag..puh*
Kom hem från tävlingen kvart i TIO, fattar ni? TIO!
Helt galet,sjukt trött..
åt lite när vi kom hem.. gick ut i stallet o fixa hästarna,var ute i ridhuset vid tjugo i elva.. wiie
Eve hoppa Harry lite,finfina är dom tsm!
Khairo va lite halvgalen men d löste sej xD Red lite markarbete/dressyr på vanliga tränsbettet, a bit strong horse men d gick bra tillslut..<3
Nu har lotta o Eve kommit iväg, o ja sitter här... framför datorn..

godnatt
/Erika

riktigt nice bild, lr hur?

Hemma efter en rolig dag!

Dagen började med att jag o mamma åkte till knalleland och mötte ebba o malin. Vi gick runt och kollade lite affärer o fick med mej ett par blåa KL strumpor. Sen stack vi ner till stan och lunch på viskan :) Jag tog en ceasar sallad, fast den kycklingen smakade typ gummi xD
aja, sen så skulle dom åka hem  så då sa vi hejdå :) Sen Åkte jag o mamma tebax te knalle o ja köpte en bok, (de lät lite nördigt xD) och ett par vita ridbyxor! Mountain Horse, helt enkla inget på dom. Va utförsälgning så vi passa på! Kan ju bra o ha mer än ett par till varberg ;)

Efter det åkte vi hem o vilade en stund, o nörd som e började jag läsa :P
Sen åkte vi till stallet o jag skulle hoppa idag, en gång innan varberg!
Ponnyn va sjuuuukt duktig idag!! Fick ett luuugnt tempo och fixa det mesta avstånden :)

Så är väldigt nöjd med hela dagen!

 

Bild från idag. Snyggiiish




//emma's

Nununu

Då vare dax... Wish her luck!..../Erika

Påväg Uddevalla....

Nåra bloggläsare där?.../Erika

Upp,upp o iväääg

Vaknat-yepp
tatt på mej- on my way
frukost-snart
åker-om  1,5 timma

nu kör vi!

/Erika

ouuuuuuhh

Drar mej till sängs nu..
har en lång, riktigt nice dag i Uddevalla framför mej...
Sleep tight
/Erika

Hej hopp!

Kom precis in, vart ute med överfina ozzy på lååång promenad...*puh* mina fötter värker XD

Ridningen idag med cooper gick lite halvdant i början, men sen vart han suuper!

la ut 2 bommar på en långsida av paddocken, med 20 meter imellan. Varierade galoppsprången allt mellan 5-8.
Cooper va jätte duktig!
O sen i slutet red ja utan stigbyglar och hoppa ett litet hinder, bra träning för balansen bland annat :)


Han är min dröm, på 4 ben, <3




//emma's

bby

I can't let you go, bby du är d ända ja tänker på


Skillnad, jaao

FÖRE
(Maja gillade att gnaga på väggarna.. märks d?)
EFTER
Skillnad...yeeepp
/Erika

Finns ni där?

Imån sticker jag till  Uddevalla..
Elin ska tävla Jerry.. o såklar så åker ja me som mentalt stöd(för mej själv)
hon hoppar LB LA..
Kmr åka härifrån vid 08.30
går upp 07.00.. käkar lite, drar ut i stallet o fixar Jerry, borstar o knoppar
packar sakerna idag
sen är ja där hela dagen, heeela dagen
rider 3 hästar när ja kmr hem.. Kakan,Carro i Dröm
riktigt nice dag
är nån av er i Uddevalla imorgon?
/erika

Dagens outfit

*Bäver keps.. fråga inte varför xD
*Förstor hockey tröja
*Försmå fleecefodrade mjukisar
*Gamla snyggisstrumpor
*5 storlekar för stora skor
Nästan ännu snyggare idag, lr va säger n i?
/Erika

Tråkit inlägg..

Ja ska blogga en massa lite senare! I promise.. Kan säga att cooper va fin idag! Hörs senare,, /Emma'S

yammi yammi

SNAAAART ÄR D FREDAGSMYS!

/Erika

no regn men tunga moln

jobbjobbjobbjobb... men frammåt går d mockat o tömt en box, målat en hel o lite på d andra också men nu, äntligen är d lunch.. hahaha kmr lite mer filmer idag tror ja.. o en galet nice outgit.. xD
efter lunchen blire mer tvätta.. o städa o lite små fix rider Khairo o Dröm idag, eve rider jerry o harry...
hur ser eran dag ut?
/Erika

Innanjobbetmobilbloggning.se

Sticker till jobbet nu.... Woop hörs later On/erika

Vad säger ni,ska vi......

Köra en FRÅGESTUND? Komentera riktigt flitigt nu,fråga vad ni vill..../emma o Erika

VECKANS BLOGG

BLEEEEV.........:

http://ellenstavlingsblogg.blogg.se



Vi diggar denna bruden grymt mkt !
Hon rider otroligt bra, effektivt, smart o smidigt.
Hon tar väl hand om sina ponnys som är sjukt fina och står för sin åsikt!
Hon har väldigt varierande inlägg o de e alltid toppen, blir roligare o man fortsätter att läsa då.

DET GILLAR VI!

We like headern, designen, det är mkt bilder och det är alltid mycket roligare då :) Hon o ponnysarna kommer komma långt kan vi lova..

Hoppas verkligen att ni kollar in hennes blogg o kommenterar , de e hon värd.



/erikaoem<3

Tänkte lite bara..

O vi vet ju alla hur det slutar om emma & erika TÄNKER....ooops...

ne men vi tänkte göra en rolig sak!
Lyfta fram några bloggar som vi gillar o läser.
För att istället klaga på allt o alla så kan man ju faktiskt va snälla mot varann o lyfta fram varann, right?

Denna cheyen är grymt söt. Hon rider as bra o toppen fina ponnys! (Hon har emmas gamla ponny Curry)
Headern är as fin o designen e cool. Läser den varje dag. Värt ett klick!

Dessa Brudarna har en super söt blogg. Gullig header o suuper fina ponnys! Rider toppen gör dom ju såklart med!

Domhär coolingarna Den här bloggen läser vi dagligen. Tjejerna är super o jätte söta! As tuffa ponnysar och dom rider kanon!

Denna lilla tösen är cheyen som har Conny nu. Så självklart läser vi den. Hon och conny e sjukt söta ihop<3

Dessa tuffingar läser vi förståss oxå. Rider super bra o har fina hästar!

 
Och självklart denna sötingen som vi läser för fulla muggar! Hon rider toppen o är jätte rolig o va med!



Detta är några av bloggarna vi kikar på o kommenterar! Gå in o ta en titt på alla , inget du vill missa!


Hope u like it,



/emmaoerika<3

bloggish.se


mer filmer kommer... men KOMENTERA flitigt nu dååe!
/Erika

Eve åker skottkärra


/Erika

hör regnet på taket

målat klart 3 boxar nu.. galet skönt!
sitter nu under ett duntäcke o hör regnet smattra mot taket.. myskänsla- jaaooo
chipsenn e framme me, mums
filmer från dagen håller på att laddas, så håll ut
yapp, dagens outfit för boxmålning:
*För liten keps från MH
*För liten pixbotröja
*För små mjukisar
*Gamla strumpor med pingviner på xD
*joggingskor i storlek 43
riktigt nice tycker jag, vad tycker ni?
/Erika

:D

Jag tror att vi just slog BESKÖKSREKORD !

Hoopas att ni även gilla Michelles gästbloggning, hon är super trevlig och rider gryyymt! Glöm inte kolla hennes & Olivias blogg!
HÄR!

Cooper vilade idag, de e han värd min lilla guld klimp <3

Innan idag vid lunch typ, gick jag o min överfina vovve på en långpromenad i skogen. De va ruskit mysigt .






 Jag o saknade lilla Allie<3



//Emma'S



In my mind

ja typ gillar dej

/Hon där blonda tjejen.. inte den me långt hår.. utan hon me d korta ni vet?

Yepp yepp back to work

luchat lite på restaurang Hultet idag igen, helt galet gott'
nu drar vi ut till stallet o fortsätter jobba... ska måla 4 boxar idag..
kmr före o efterbilder sen n är vi är klara
Red Khairo medans Eve hoppa Harry förut
Khairo va grymt fin, helt gal1...den ponnyn är elit 4real!<3
Hoppningen för Eve o Harry gick kanon! hon ska ju hoppa han i Varberg eftersom jacky vilar..
red  Carro i hagen oxå, eve red dröm
pigga,glada hästar... yammi
/Erika

rider all morning

Dagens:
*Vakna
*Äta
*Blogga
*Byta om
*Rida Khairo
*Rida Carro
*Måla12-7
*Chilla
yepp som ni ser, dagen börjar bra o slutar bra....
alltid någonting
/Erika
Min fina Carro<3

/Erika

Gästbloggning 5

  • Hej alla blogg fan! (jag är också ett) Jag heter Michelle Hoffback och har en blogg med min polare Olivia Taylor. Jag har blivit "erbjuden" å blogga på denna grymt besökrika blogg och jag tackade givetvis JA! Jag är 14 år och har som sagt en mycket framgångsrik blogg med Olivia. Vi satsar stort på den och det går frammåt! Jag känner mest Erika på denna bloggen men även Emma lite också. Jag träffade Erika första gången på ett ridläger som var hemma hos henne och då hade jag min gamla ponny Greta! Snabbt lärde jag känna henne och hennes riktigt Goa humor som ni säkert också har träffat på..xD haha.. Men enligt mig är Erika Wenderyd en otroligt framgångsrik elit ryttare som jag vet kommer nå den högsta toppen både på ponny och srorhäst! Och så Emma sahlberg! Emma är en väldigt knasig go tjej enligt mig!! Henne känner jag inte så jätte mycket men har träffat henne några gånger och hon är hel ball! Hennes ponny Cooper är också sjukt ball tycker jag !:) Emma och Cooper kommer inom inte så lång tid komma upp till Sm nivå utan problem om det går så bra som det går nu, och tro mig ! Det går awesome!! Och tillbaka till mig nu då haha! Jag är en både ponny och storhäst ryttare:) jag har en vit C-ponny som heter Tyson och så har vi en storhäst som bara är 5 år men som redan debuterat 120.. Min ponny Tyson har jag tävlat upp till MSV B med och jag har ägt honom nästan 2 år! Men han är väldigt speciell.. Någon som kan gissa?…han har bara ett öga! Jeppsson ni läste rätt! Han har bara ett öga! Förra våren hände det ofattbara! Han fick en slags svamp i ögat som åt sig inåt i ögat och fastän vi var hos veterinären ca 5 gånger då vi tyckte han betedde sig konstigt såg de ingenting.. Till slut Blev vi nerskickade till SKara där min ponny var tvungen å stå i näästan 1,5 månader.. Han vilade alltså rejält länge.. Tillräckligt länge för att alla muskler ska försvinna.. 1,5 månader hjälper inte nej, han var tvungen å vila ytterligare 4 veckor på de! Så ungefär nästan 2,5 månader fick han i vila.. Det tog väldigt lång tid men tillslut blev han bra och vi hade just kommit igång för tävlingarna 2011! Men så får han bajs i kotleden!! Men nu är han bra och vi laddar som f*n inför denna säsong!!!:D Tycker ni att jag var lite smått intressant? Varför inte slå en titt på våran blogg? Always------->www.michelleocholivia.blogg.se
---------------------------------
Grym chey, galet söt o helt underbara hästar
hoppas ni diggare henne lika mkt som jag
tack Michelle
/Erika

suussar

nu..
tar en snabb dusch o sticker ut i "vårat hus"
nanar lite o taggar(host*) inför morgondagens målning o skurning...

red Khairo i ridhuset när Eve red Harry, gick kanon
båda hästarna var super fräsha
Sen red vi ut med Dröm o Jerry barbacka i skogen, galet mysigt
o ni vet ju, jag äälskar skrittpromenader iu skogen, 4real!

/Erika


vi sänder en tanke

till dej...
¨tycker att ALLA ska gå in på http://mirellathelander.blogg.se o skicka iväg en stöttande komentar till denna grymma cheyen
läs o tänk efter,... det hon går igenom just nu är inte lätt
så skicka iväg en stöttande komentar, hjälp henne med ditt stöd...!

livet är orättvist, har aldrigt sagt nått annat

kram på dej Mirella, om du läser detta.. så vet du att vi är många som är med dej!

/Erika



Emma liiiiikee

Jag diggar den nya designen asså, o headern, MUMS.

Den lär nog INTE bytas på ett tag framöver...

see ya,


//Emma'S


Ponnyn e ELIT!

Dagens ridpass va sanslöst underbart! Går inte att beskriva asså.... Så jäkla GRYM.
Är så stolt över honom, han gick i avslappnad form hela tiden, försökte inte ens dra upp huvudet en enda gång!
(För Han tycker det är super mkt roligare att leka giraff ist för att gå i form...) Och det bästa av allt är jag inte ens red me graman ;) Han va sjukt underbar idag i alla gångarter!
Bara log hela ridpasset :')

Och såhär busig va han idag ;)




Ska jag sälja denna ponnyn någon gång? Njaaa, skulle inte tro de va ;)
Du e min, bara min o så kommer de förbli föralltid<3




//Emma'S

nytt

Va tycker ni om den nya headern+designen?
Tycker själv att den blev 7kt fin o är galet nöjd!
tack så jätte mkt----> Cassecuck.blogg.se

/Erika

om jag säger

bloggtävling, vad tycker ni då?

vill ni ha en till tävling?


/Ni vet, Emma o Erika

bara till dej..

Ceci est juste pour vous, vous savez qui vous êtes ... Vous me manquez beaucoup beaucoup beaucoup! A très bientôt? Peut-être avez à une soirée entre filles? <3

/Erika

mums

sticker iväg till Restaurang Hultet nu, pannkakor står på menyn, mums
är pretty hungrig nu efter 2,5 timmes slit, haha
tömt 3 boxar nu, håller på med den fjärde.. sen blire till att högtryckstvätta, wiihoo
kommer nog komma upp lite filmer, galna filmer på mej o Eve som släpper loss i stallet, haha xD
så håll koll!


/Erika


jobbar nuuu

fixat lite i gäststugan nu så att jag o Eve kan bo där d dagarna vi jobbar
blev rätt najs faktiskt..

Nu har vi iaf vaknat, sov rätt dåligt o drömde en galet sjuk dröm xD
så är ganska trött o pretty stel idag
men men
drar ut i stallet nu, jobbar 11-17, woop woop
ska tömma ALLA boxar från strö, sen högtryckstvätta o skura.. o sen måla om allt
ååh så roligt!
men som sagt, va gör man inte för sina hästar??

/Erika


svara igen

Ella  (e.olssonbroander@hotmail.com) om playhouse:
Arrêtez d'écrire en français, il suffit d'avoir cette langue embêtants à l'école ;)
IP: 81.237.221.202
13 Juli, 10:42  
Anonym om playhouse:
Avsluta huset nu med Evelina, kommer att vara vårt hem för några dagar ... Kommer att arbeta hela dagen i morgon, men kommer naturligtvis att blogga ändå!
såg Iman
översatte de men fattar endå inte :S
IP: 83.189.151.232
Ella:
ok alors, mais juste parce que vous êtes si douce et disparus!

Anonym:
Haha, ibland kan översättningarna bli lite konstiga eftersom fransmän inte har samma ordföljd som vi ... i det inlägget skrev jag:
Drar ut i lekstugan med Evelina nu,kommer att vara vårt hem några dagar framöver...
kommer att arbeta hela dagen imorgon, men bloggar såklart ändå!
Ses imån
Erika

kram

playhouse

Sortez dans la maisonnette maintenant avec Evelina, sera notre maison d prochains jours ... Sera travaillé toute la journée demain, mais sera bien sûr de bloguer en tout cas!
vu iman
Erika



Svar-igen

Julia om oui, il semble en fait assez bien ....:
Hej!

Kan inte du skriva dina mål med alla hästarna? :)
*kram<3
IP: 213.66.99.15

Jo såklart!

Dream Boy(Drömmis) Har inga jätte stora mål med Drömmis men hoppa Sm med bra resultat är väl någonting jag ändå sätter som ett mål... Att fortsätta tävla Msv,Vinna en Msv B o kanske tävla nån mer internationell

Harnells Tricky Dicky(Harry) Komma igång efter vilan.. Komma upp i klasserna o Hoppa msv B med placering, o kanske även starta en Msv A innan året är slut.. O fortfarande är det så att vi håller på att lärakänna varnadra..i dressyren är d att få en gämn form o att han trampar under sej med bakbenen

Drishoge Khairo(Kakan) Lära känna varandra, bli ett team... Hoppa fler Msv B med stabila rundor o gämna resultat. Kvala msv A o debutera innan året är slut.. Ta lite placeringar i LA-Msv B

Carolyn(Carro) Fortsätta med gämna resultat o rundor.. Hoppa lite fler 1.20 o kvala 1.30.. kanske till o med debutera 1.30 iår.. Få tävlingsruti... Jobba med att få en gämn bra form där hon verkligen arbeter i markarbetet


detta är väl nåra av d mål jag har nu..
såklart är det fler lite mindre mål o så...

Kram
Erika

Svar

Sabina  (sabina@hotmail.com) om GP-PONNY RESAN:
Hej! Jag har själv funderat på att börja skriva här. Varför har du valt att blogga här och inte någon annanstans?
IP: 173.208.46.113
12 Juli, 21:08  
Anonym om GP-PONNY RESAN:
Ska du hoppa SM på Drömmis i år fast du inte har kommit runt någon msv a ?
IP: 213.66.99.15

Sabina:
om du menar varför vi valt blogg.se så är det för att det är roligare o finns mer inställningar att fixa med bloggen... + att headern o design blir mycket bättre!

Anonym:
Ja, såklart jag ska hoppa Sm! Hoppad ju flera Msv A:er förra året me placeringar o nollrunder.. Har ju oxå hoppat Msv B+5 senast i våras i Norge, o det gick ju jätte bra! Och så är d ju så att bara för att jag hoppat EN msv A iår o att ja trilla av den, inte betyder att d kmr gå likadant d andra gångerna :)

/Erika

Gästbloggning

Hej alla!
Jag heter Julide Yoldas och är 14 år och bor i Norrköping.
 
Jag har en C-ponny vid namn Cadfach Rhufeinaidd men även kallad Råbert. Han är född 12 April 2003. Han är Welsh Cob.
Jag köpte honom 9 Maj 2010 då han mest hade gått Dressyr men startat upp till LB hoppning.
I dressyren gick han upp till LA med plac.
Nu tävlar vi bara hoppning då jag inte har tagit tag i dressyren riktigt än, tränar dressyr ett par dagar i veckan men inte för instruktör. Hoppningen tävlar vi upp till LA nu och satsar på den sista nollan där nu sen är jag  kvalad MSV B.
2012 kommer jag vara med i Kinda Ridklubbs Elitlag!
 
Råbert är min kung som alltid vill prestera bäst, klart alla har sina sämredagar men han försöker jämt vara på topp.
Kul att få gästblogga här, kan ju säga de att jag lärde känna Emma på Sveriges bästa ridläger AW, Emma är bäst och jag saknar henne massvis! <3
Glöm inte att kika in på min blogg: www.juulideyoldas.blogg.se
Kram












Jag diggar denna bruden asså, hon e så otroligt underbar på alla sätt o vis! & har en så sjukt söt ponny.
Saknar den lilla tösen!<3

//emma & erika


oui, il semble en fait assez bien ....


est-ce seulement moi qui pense ce n'est du plaisir à ce regard très significatif laid? Presque comme si l'on peut croire que j'écris des romans de façon spectaculaire et atteint importante ..

ingen rast o ingen ro

Drar ut i stallet nu..
Tar o lösgalopperar khairo lite i ridhuset, så han kan springa av sej all energi..om d går xD
Tror helt seriöst att han ALDRIG blir trött
fast d är ju bra, oftast..

Eve kmr runt
18.30
Ska rida Drömmis o Carro när hon rider Jerry o harry
Sen stannar hon här o bor kvar tills fredag lr lördag... ooo va kul tänker ni säkert
MEN
D är inte så att vi ska chilla o bara va, nänääh
vi ska TVÄTTA ur HELA STALLET med högtryckstvätt o sen MÅLA om d... suck
men d blir mitt ända sommar jobb o vi får ju betalt så, ofc vi gör d ;)

så denna veckan blire mkt slit
fram tills på lördag, då åker ja me Elin o Jarad till Uddevalla..
nån Bloggläasare där?


/Erika

visste ni...?

*Att jag får jätte mycket fräknar på sommaren..o inte bara i ansiktet utan även på händer,fingrar,knän...xD

*Jag har aldrig färgat lr slingat håret

*jag älskar att skritta barbacka o mysa i skogen

*Jag skulle vilja starta ett eget "ridmärke"

*Jag älskar kläder o assesoarer!

*Måste hålla igång hela tiden... Klarar inte att bara sitta i soffan o chilla...

*Om jag skulle vara kille skulle ja hetat Linus

*Har lätt för att skaffa nya vänner

*Egentligen jätte rädd för att åka sakerna på Liseberg men gör d för att d känns bra efteråt (a)

*Tävla är seriöst d bästa som finns, hästarna<3,vännerna o spänningen!

*jag är en badkruka

*tänker på någon ja gillar just nu...

*jag planerar alltid varje dag på morgonen, tänker ut exakt hur d ska vara,tidsprogram o ordning xD


/Erika


hej hej nya garderoben








Spetsväst: Ten, Frankrike
Vita byxor: Ten, Frankrike
Jeans med gulddetaljer: Ten, Frankrike
Jeans med spets: Ten,Frankrike
Pannband: Swarovski, Charlies
o så har ja bytt fram o baksida på iphonen så nu är den guldig (a)

o som ni ser, Ten.. Va min absoluta favvo affär i Nice xD
Helt galen affär me grymt häftiga kläder!

Va tkr ni om mina shopping resultat?

/Erika

Resan i bilder












/Erika

Vakeeeeeeeen

vart vaken sen kvart i 9 typ, seeeent!,
känner mej inte på topp idag, så ligger o slöar i sängen ;)
Ikväll blir de väl riding på schemat! lite lydnad tänkte ja gö idag :)

ha de gött!



//Emma'S






va gör man idag då?

vaknat-check
uppe-check
frukost-?
taggad inföer dagen-njaaa...

såå? Va gör man idag då?

Erika Wenderyd-Curries Geronimo

/Erika


5 Saker ni kaaanske inte visste om mej...

Som ruriken lyder!

här kommer 5 saker,  enjoy.


* Jag är LIVRÄDD för spindlar, men andra småkryp går bra.

* Ibland är ja blyg, ganska försiktig av mej. Om de e folk som jag inte klickar med. Men är det människor jag trivs med kan ja va mej själv o prata som tusan!

* Jag kommer ihåg ALLA tävlingar jag startat. VARJE klass! Och även hur det gick för andra. Oftast jag som kommer ihåg åt mina kompisar ;)

* Jag har ALDRIG färgat håret.

* Jag älskar att få nya vänner, när folk accepterar mej för den jag är. Älskar det , verkligen. Va me nya människor, o skaffa siig underbara vänner, soom jag alltid ställer upp för till 110% & hoppas folk gör likadant.





//Emma'S

hej alla glada o goa!

Hoppas ni mår toppen bra, för de gö ja!
Är så sjukt taggad te varberg, (typ skrivit de 40 ggr men ...) ska bli sååå kul!

Ska ni dit? Roligt o veta så kommentera isåfall :D

Tänkte ba göra en liten spontan grej i nästa inlägg, hahah emma goes snäääällll.

Så kika o kolla på de ja lägger ut, de e gryyymt!

känner att de ofta blir lite korta inlägg, men har lite torka just nue, ska skancka med min överfina erika o se om vi kan komma på nåt ku!

håll utkik om en stund!



//emma'S


Cooper is amazing!

Cooper va så otroligtfin idag igen! Denna vilan har nog varit honom god! :D Han är så arbetsvillig, o så himla go så man bara ler när man rider!

ÄNNU MER TAGGAD TILL VARBERG! ska bli så fett kul..

och själklart mobilbloggar jag när ja e i varberg, så ni vet hur de gåååår ;-)

love from yoooooour em!



hem igen dååeee

sitter på flygplatsen, igen
fast den här gången går planet hem t Sverige
skönt, men ja.. tråkigt
haft d underbart här
solat grymt mkt,badat en del me kan ja säga.. o såklart blev d en del shopping

kmr bilder,massa bilder när vi är tbax
d lovar ja

tills vidare
ha d gött

kram Erika

suck

då vare dax igen

/Erika

måste bara fråga

lite skum fråga men....
vad är d BÄSTA ni vet?
Asså va tkr ni är d roligaste,underbarste o ja bästaste att göra?

bara kände att ja ville veta xD
haha

ni har nog inte så svårt för att lista ut mitt svar va? xD
ganska självklart

/Erika

Hej då

Drar hem t Sverige idag igen...
kmr sakna allt här
värmen,havet,doften,staden,maten
allt
men längtar ändå lite efter allt hemma
vännerna,hästarna,mina totalt ogosiga katter
oo.. ja, ER såklart!

oo förhoppningsvisså är jag brunis när ni ser mej nästa gång
förhoppningsvis...

/Erika


Gästbloggare nr 3

Hejhej alla Emmas och Erikas läsare. Jag heter Felicia och är 14 år.
Jag rider- självklart, jag tävlar på min c-ponny Moflos Zorro och tillsammans har vi tävlat upp till MSVA hoppning.
Jag rider inte bara utan spelar också fotboll, men jag brinner mest för hästar och ridning!
Jag hade tänkt att skriva om något viktigt; att aldrig ge upp, allting går om man bara vill!
Jag fick min fförsta häst precis innan jag fyllde 8 år. Det var en b-ponny, söt som socker, men helt omusklad och han kunde ingenting!!
Men jag älskade honom ändå!
Jag fick sitta där och rida lektioner på en häst som inte gick att fatta galopp på, eller som bara sprang om man la på skänkeln.
Jag var bara åtta år och inte så rutinerad. Men jag fick kämpa. När jag började tävla, så stanna vi ut oss, gång på gång. Jag fick inte så många placeringar.
Men jag gav inte upp. Efter några år släppte det och det gick jättebra.
TRE ÅR tog det att få iordning på hästen innan han fungerade, och då gick vi ut och vann alla våra starter.
Vi tog oss inte till SM men det är inte det viktigaste, han blev klockren i LA hoppning och det räckte för mig. 
Den här hästen var 15 ÅR när vi fick han och han kunde ingenting. Nu är han 21 år, och har vart halt i över ett år, så ja, jag vet inte vad som händer.
Men i vilket fall som helst, så gav jag inte upp, jag fick han dit jag ville.
GE ALDRIG UPP; ALLTING GÅR OM MAN BARA VILL!
 
 
Första bilden är precis när jag fick honom.
Andra är sen när vi fick iordning på honom.
Tredje är en bild på mig och Moflos Zorro.
Fjärde bilden är på mig.






--------------------------------------------------------------
Diggar denna ´cheyen starkt, hoppas ni gör d me
Tack Söta Felicia för att du ville gästblogga!

/Erika

vill

veta vad ni tycker om d två gästisarna? kmr en till ikväll....
o denna personen,är en tjej med mycket utstråling o känsla
en riktigt go tjej
söt tjej
o ja, underbar

så kika in sen, för dååå ni

/Erika


Inhandlat på Falsterbo!

Här kommer grejern jag köpte på falsterbo!




*Grimskaft
*Schabrak
*J.W Schabrak
*J.W Luva
*Pioneer stövlar
*pip-leksak till vovvsi
*Hundben till vovvsi
*KL tröja
*KL regn jacka

Sen fick ja o mamma 2 gratis telefoner, (?) när vi skrev om nåt på våra telefoner.
Den va super söt o de blir nu min "stall telefon", ifall man skulle tappa den så går ju inte den sönder lika lätt som min Iphone.


Tack fina mami för sakerna<3


(Bilden på mej är AW's Broschyr!)



//Emma


ridit cooper!

red cooper i paddocken, shit va fin han var kan ja säga!
Jag är så glad, o detta gör mej bara mera taggad inför VARBERG! ska bli så himla roligt :P
åh va jag har saknat min lilla pooooniii<3






//Emma'S

tankarna snurrar...

men ja vet va jag vill.....

but somethimes its hard and you don't know what to do.....

/Erika

Hooooome from falsterbo

kom hem väldigt sent igår kväll!
Kan säga att jag är helnöjd med dagarna o införskaffat massa fiiint!
Berättar allt sen när jag kommer hem, för nu ska jag till min sjuuukt saknade ponny o rida<3


 


//Emma

vill ni......



............Träffas i sommar?

/Erika

godmorgon

godmorgon på er!
vaknade precis
ligger o drar mej i sängen
rätt gött ändå
att få bara vara
inte nåra måsten, bara lata sej o känna sommaren
d behöver jag...
slippa tänka,slippa göra massa, slippa stressa
bara ha d härligt
underbart!

va gör ni en sådan här fin dag? lr är d en fin dag i Sverige? xD

sköna sommriga hälsningar Erika


Bild på Eve o Jacky bara för att dom e finfina o bilden skriker SOMMAR!

på g asså

just nu..
nununununu
känner ja att jag är på g
jag är så galet taggad
taggad för allt!

ja känner mej stark,glad,frammåt,laddat
allt är på topp!

Hästarna funkar great,vännerna,vädret,familjen!
grr... ryser

så nu kör vi sommaren 2011

/Erika

gästbloggare nr 2

Hej Jag heter Evelina Sandén och är 14 år, jag har ridit i ca 4 år nu tror jag hehe, föra året red jag Erikas förra B-ponny som hette Maja, henne hoppade jag L.C-L.A med. Nu rider jag en C-ponny, som oxå är Erikas hehe, men a i alla fall, han heter Skånhällas Jackpot och har hoppat MSV B med Erika förra året, han har jag inte tävlat mer en 1 gång, han har varit skadad nu under ette litet tag så han är under igång sättning men sen när han är frisk så är det SM som gäller!! ne skoja haha men ska väl tävla nån L.C-L.B under året nu :D:D men här kommer i alla fall Lite om hur jag lära känna Erika och Emma, vi börjar med Erika..

Erika, lärde jag känna genom min förra bästis Therese heter hon och hon var rätt bra kompis med Erika innan. De började med att jag följde med Therese till hennes hoppträningar som Erikas mamma håller i, efter som hon är hopp tränare, (Veldigt bra dessutom) men i alla fall så efter ett tag så började jag rida maja lite lätt, Efter ett litet tag så började jag rida Maja lite mer.. sen blev de bara mer och mer... osså var det under en gång efter vi hade ridit Maja och en av hennes ponnysar, så frågade hon om vi kunde göra något och de ville jag ju GÄRNA!! hehe! Nu då är vi BÄSTISAR hehe och har varit de i ca 3 år ne men kanske 2- 2 1/2 år elr nåt,

Emma, lärde jag känna igenom Erika efter hon hade sålt ett pandband till Emma, osså efter ett tag så skulle Emma komma till Erika när vi var med varandra och skulle fota Erika när hon red på hennes underbara små ponny pluttar :D:D och nu efter kanske 1 år så är vi rätt bra kompisar hehe :))

Jag har även själv en blogg som jag skriver lite om mig och min ponny och lite om vad ja gör och mina vänner och så,

om ni tycker min blogg värkar intressant så är de bara att gå in och läsa :D:D hihi

www.evelinasanden.blogg.se

XoXo Evelina ♥

jag och min förra B-ponny Maja

Jag och mina nya ponny Skånhällas jackot

-------------------------------------------------------------------------------
Hoppas ni diggar denna tjejen, för d kan ja lova, d gör jag!
min bästa,goa,glada älskade Evelina<3

/Erika

.

Jag VILL.
JAG vet vad JAG vill göra nu.
För visst kan man brinna för 2 saker, right?
And I know what I wanna do.
Jag är till en 99% säker att detta är vad jag vill göra, för resten av mitt liv.
Tyvärr kan jag inte berätta for you bloggläsare, kanske ngn gång i framtiden...
Men jag vet vad jag vill, och jag haar bestämt mej.

Jag kan om jag vill, kommer lyckas, kan klara ALLT.
Jag har människor som tror på mej. Det är allt som behövs. Peppande människor.
Folk som tror på en.
Och visst kommer jag att stöta på folk som inte tror på mej, som säger dumma saker , som trycker ner mej. '
Men alla dom sakerna kommer göra mej starkare.



/emma'S




My darling <3






You are my everything, <3


Together we can make it to the top!


//Emma'S

veckansblogg

kmr ni ihåg att anmäla er till den nya "grejjen", veckansblogg?
Vi kmr att utse "veckansblogg" nästa vecka när jag kmr hem från frankrike

skriv eran fina bloggadress här, vi checkar bloggen o väljer den finaste,bästa o roligaste

vinnaren varje vecka får en länkning!

/Erika

Tja!

Har det GREAT right now asså, massa gött folk, o shopping!

byebye sweeties hörs later on!


 



// Emma'S


uppe

vaknat- check
uppe-check
frukostbuffé-check
sol klar-check

redo för en galet härlig dag på stranden o Nice stad

tjaa,livet kunde vart sämre

/Erika


solen,havet,luften allt

är underbart här i Nice!
Har troligtvis spenderat hela dagen vid vattnet..
solat, bruuun
d är varmt,skönt o allt är perfekt
fett nice

njuter av varje sekund här
o nu äre bara 3 dagar kvar..
första dagen avklarad
om 3 dagar kmr ja hem igen
hem till "kalla" Sverige

kmr sakna allt här, men va fasen
allt som betyder finns ju hemma i Sverige
ni,vännerna,familjen,o såklart mina goaste hästar

men, varför ta allt d nu?
Nu ska ja bara ha d härligt

va gör ni en sådan här helg?
/Erika

Nice,för längelängelänge sedan, på den tiden jag var en liten Erika

till dej

Du är min kära gullegris
jag älskar dej min lilla fis
du skrattar gött o ser rött
med det är ju me fött
d gör inget att du är ful
för vi har kul
jag tänker på dej dag o natt
på dej, i din lila hatt
att ha dej nära för mej glad
du är som ett grönt blad
allt du säger är rätt
fett lätt
du dansar o sjunger rått
för d är den röst du fått
o när du ler, ser jag dej
som en söt tjej
för d är vad du är
mitt lilla söta bär

Evelina Zetterström Sandén<3

/Erika

GP-PONNY RESAN

Yepp, här kmr den.. min GP-ponny resa i text
från början till slut

Kval

De va kallt, det minns ja
vi red fram på en liten plätt av paddocken, där de hade lyckats ploga
runt om var d stora snödrivor
marken var stenhård o annat än skritt o trav va inget att tänka på
Drömmis hade 3 täcken på sej, ja hade lika måpnga jackor..
handskarna var iskalla även om d var d tjockaste vintervantarna
tårna frös fast i skorna(tro mej, ingen överdrift)
tillslut, efter ca 35 minuters kyla fick vi komma in i det lite varmare framhoppningsridhuset
tog av nåra av jackorna, o täckerna
satte igång me galoppen
Drömmis kändes fin,lite seg men fin
hoppa fram lite på räcket o oxern
funktionärerna ropade att ERIKA WENDERYD skulle hålla sej beredd
pulsen gick snabbare, d kan ja lova!
nervositeten steg
ska vi klara att ta oss vidare?
jag kom in på banan
skrittade runt lite
visade alla blommor i hörn o hinder
i högtalarna kom d vi väntat på
-Erika Wenderyd, Dream Boy... Tävlar för Kungsbacka ridklubb, VAR SÅ GOD OCH RID
hjälp, nu vare dags!
skrittade fram till dommaren o hälsade
fattade galopp o red mot första hindret
allt kändes bra..
jag fick ut honom i hörnen
kom rätt på d mesta
hoppade runt banan med NOLL fel
grymt glad
fick en rosett på väg ut från banan
sen var d värsta
VÄNTAN
Gick runt me tre lager kläder o väntade spänt på resultatet
hela klassen gick................................
57 starter, en riktigt lång väntan men NU skulle vi få VETA hur hade d gått?
Speakern ropade upp d 10 som var vidare
1... inte ja.. 2.. inte ja... 3 inte ja....
o på Ddelad 4:de plats ERIKA WENDERYD 56 poäng 
JAG VAR VIDARE!
Helt fantastiskt, lyckan va enorm!
Fick gå in till fots, fick lite priser
o fotograferades

vägen hem var enkel
för ja visste att jag skulle få hoppa Semifinal


Semifinal

Februari..
kallt, nu med
fast den här gången fick vi rida fram inne
puh*
ska jag vara ärlig minns jag inte jätte mkt från semifinalen
var väldigt nervös!
Men jag kmr ihåg lite..
När jag skulle gå in på banan..
skrittade in lugnt..
Förra ryttaren var felfri, o hade en stor hejarklack med sej
o neej
D skrek,klappade händerna,stampade i läktargolvet
Drömmis blev livrädd
for runt i full galopp i ridhuset
fick rida in i väggarna för att få stopp
han backade,hoppade,snurrade.. ja panikslagen
Speakern ropar mitt namn o vi får startsignal..
på nått sätt lyckades jag ändå hälsa
satte av i full galopp
kämpade för att få ihop honom
tja,lyckades okej
gick väl lite fort men ja menar, han var galen!
hoppade runt banan felfritt
rätt antal galoppsprång imellan hindren

men nu var d den eviga väntan kvar igen
fast denna gången var vi ju bara 30 startande...
Ett tag hade d en storbildsskärm där man kunde se ställningen i klassen
men den tog dom ner efter en stund för att få mer spänning
jag hade ingen aning om hur d hade gått för mej när klassen var slut
INGEN visste

när jag stog där o väntade så kom det en reporter fram till mej
han sa grattis o undrade om han fick "intervjua" mej
o jag bara, Vaah?
fattade ingenting
då sa han: - Ja? Men du kom ju 6:a? du är ju vidare!
Då förstog jag'
jag, JAG skulle få rida på SCANDINAVIUM!
Han tog bilder
frågade,snackade o ja sånt som d brukar göra xD
jag var helt överlycklig
ja menar, där stog jag, nyss fyllda 12 år o skulle få rida på scandinavium med min älskling ponny?
Helt grym känsla!

efter prisutdelning o allt fick vi gå upp i ett konferansrum o fira
10 tjejer
överlyckliga tjejer
vi fick GP-ponny tårta som såg ut som årets märke
efter allt detta fick vi åka in med hästarna direkt till scandinavium o rida
för att känna på d...

den kvällen, var jag så lycklig som en 12 åring kan bli!

Final

Jag var inte nervös
inte ett dugg!
o d är faktiskt sant.......
Nu hade jag nått målet, jag hade kommit dit jag drömt om
o jag hade helt enkelt inget att vara nervös för!
Drömmis var fixad,perfekta knoppar,hovolja,putsad o fixad till max!
vi red en bit genom stan för att komma till arenan
folk stirrade, mycket!
Red fram i ett Ja, va säger man? Ridhus? ja där d vart en hockeyrink innan iaf...xd
funka bra!

banan var klar
dax för bangång
bangången var lika roligt som allt annat
där, inne i scandinavium stog det en bana, en bana för MEJ, en bana för OSS!
Där gick jag, medans andra ungdomar satt på läktaren o drömde om att få gå där nere,
att få gå banan till SIN klass på Göteborg Horse show
precis som jag hade drömt innan
banan var bra
passade oss!

klassen började..
det fanns en TV nere på framhoppningen så att vi kunde se alla rida
goosh va fint alla red!
d blev min tur..
jag skrittade upp till ingången
mamma ledde Drömmis o gämte mej gick Jenni
min bästa vän, o den som jag valt att ha med mej som hästskötare
jag blev insläppt på banan
jag såg mitt, MITT, namn på den stora tavlan i taket
ERIKA WENDERYD
DREAM BOY
stog det med stora bokstäver
läktarna var fulla
12.000 människor satt o tittade på MEJ!
herre gud, händer detta?

Jag får startsignal
startar..
Drömmis, min söta Drömmis.. var LIVRÄDD!
Alla blommor, allt folk allt, ja allt helt enkelt
det var så mkt överallt!
vi fick ett nedslag
men han var väldigt duktig!
men jag grät när jag kom ut, för jag ville så gärna nolla
nu, efteråt tänker ja, Varför grät jag? Jag hade ju nått drömmen, hela vägen!

eftersom jag var den ända med 4 fel så slutade jag på en 10 plats
10, sist i GP-ponnyn?
nej, jag var absolut inte sist
jag var 10 av 180 startande!
av 180 C-ponny ryttare som startade GP-ponnyn i Sverige så var jag 10
grymt

men, det bästa
det jag minns mest
det jag plockar fram ibland innan tävling lr för att må riktigt bra
är prisutdelningen
inte själva grejen när vi stog där inne utan när vi skrittade in..

Hela Scandinavium var mörkt
strålkastare åkte över den tysta arenan
vi stog där, utanför i ingången o väntade på att få komma in
musiken startade långsamt
dododododoDO DO DO DO, DO DO DO, DO DO DOoooooooh
Rising up,back on the street...
I of the Tiger, en grym låt att rida in till
12.000 människor klappar i tackt till musiken, ni anar inte hur häftigt det var


 Över hela scandinavium hör jag
- PÅ TIONDE PLATS... ERIKA WENDERYD DREAM BOY!

Jag skrittar in helt ensam, in i ett fullsatt Scandinavium med klappande publik o grym musik
mina vänner, min hejarklack skriker
o då känner jag, JAG DRÖMMER

Den känslan jag hade när jag red in där
den tar jag fram
jag tänker mej tillbaka, tänker hur underbart det var..
det är en sak jag vill uppleva igen
o det ska jag
o det kämpar jag för!



Hopaps ni orkade läsa hela texten o att ni daggade det!
kram Erika

o bilder , D kmr snart, lovar!

gästbloggning nr 1


Valde denna cheyen för att hon är cool,söt o har ruskigt söta o fina hästar, så här har ni.. gästbloggning nr 1

In FALSTERBOOOO!

Yupp, nu e jag i falsterbo! härliiigt värre!
Hoppas ni har de lika gutt som ja har dä...


lite tidsinställt dåååvaa xD

menmen,, när jag kommer hem lär ni får se vad jag har kööööpt!!!



hörs later on..


//EmmaSahlberg






favvo bild i repris<3

on da flygplan

sitter på planet, tror jag
har la typ 40 min kvar.. tar ju bara 2 timmar o 40 min typ
så rätt chill resa ändå

kmr nog spendera resten av dagen vid stranden o poolen..
fett nice
sen blire väl till att gå ut på stan en stund, checka lite affärer o äta på restaurang på kvällen
mmm....

men, tro inte att ja inte saknar er!
Kan ju inte blogga här ifrån Nice som ni vet..
ush

hoppas ni står ut me mina tidsinställda

kmr en del kul, gästbloggare,filmer ja, lite smått o gott

så glöm inte att kika in här, även om d inte är live bloggning
för d blir nice ändå, d kan ja lova

kram
Erika


last inlägg

yepp, då vare snart hem igen..
Tillbringat dagen i Falsterbo, o ja ni förstår ju att d va grymt
träffat massa nice people, o skrattat massa
... då are bara ett år t nästa gång
Suck*

detta är d sista inlägget ja gör innan vi åker t Nice...
kmr sakna er, d kan ja lova
men, ni har ju Emma

kmr sakna allt, men ja är ju inte borta så länge så d löser sej nog

va händer för er denna helgen?

/Erika



In the caaaaar!

Nu sitter jag o min fina mamma i bilden på väg ner till skåneland. Ska bli sjukt kul Asså!:) Ja hoppas ni haft en toppen dag, o kommentera på här på bloggen! //emma

!

hemma nu från stugan! o precis duschat o käkat lite. O nu ska vi snart åka till skåne!
Kommer tidsinställda under tiden så bloggen är inte helt off.
O missa inte alla gästbloggningar! :D Spännande kan ja säga...
Men
Och min fiiina
Ella ringde mig o sa att på AW's monter i falsterbo fanss de en ganska stor anisktsbild på mej xD jag blev lite paff, o en på mej o manda<3 Så nu vet ni att de e jag som sitter där, (o i katalogen!)

Hare bra ja mååste skynda nu!!





//Emma

taggatgaggatgagga

ppaarrttyy

yeah,yeah,yeah,yeah

Nu kör vi!

/Erika


My place


/Erika

check-check

Uppe-check
fixat stall-check
klar för att åka-check
laddat inför FALSTERBO-check
gillar att checka-check

yepp nu drar vi t Falsterbo, woop woop

är där hela dagen o chillar
nice

blir nog en del shopping, hehe
o bilder, d kmr nästa vecka, när ja kmr hem från Nice
--------------------------
Är d nån bloggläsare här i Falsterbo?

/Erika

svar

Anonym om Hello!:
Var ni tycker den bästa tävlingsplatsen är och varför ;)
IP: 2.66.50.140

Hej!

Jag tycker nog att Grevagården är den finaste anläggningen jag varit på... I Sverige

Det finns två fina ridhus med super underlag!
två grusbanor och två gräsbanor.....
fin caféteria,bra mat o fina stallar....fina hinder o uterittsvägar har dom oxå
så jag måste nog säga Grevagården RF :)

Utomlands är den absolut finaste anläggningen Drammen...
Riktigt fina stora utebanor med grymt underlag, fina hinder och bra banor!
dock sådär bra cafeteria men d klarar man väl sej utan? ;)

Kram Erika

såhär seriös är jag


/Erika

Hello!

 Underbara läsare.

Är det något ni vill att vi ska skriva om? ni får önska 2 inlägg var.
Så fixar vi det så fort vi kommer hem!


love em and erika


ET O'Connor<3

Ibland saknar jag dej så mycket så att det gör ont.
Men du har det bra, det är ju huvudsaken.
Josefine älskar dej precis lika mycket som jag.
Vi gick olika vägar helt enkelt..
Jag kommer i sommar, du ska få en kram. Antagligen kommer jag fälla en tår oxå..
Och känna den dära obehagliga känslan när jag ser dig , när det inte är du&jag längre, jag inte kan förklara i ord.
Kan kännas lite främmande, då du inte längre är min.
Eller bara vara lycklig när jag träffar dej. Över att få se dina busigt vackra ögon.

Loved you once,
Love you still,
Always have,
Always will.















//Emma'S


i morn bär de hem...

japp, i morn ska ja o mamma åka hem o senare på eftermiddagen åker vi till skåååne!
Så de blir bara några tidsinställda från både min o erikas sida :) Men de får ni stå ut med ett tag bara ;)
Kommer hem sent på lördagen, så om ja orkar kanske ja skriver då.

 

Min fina <3



//Emma'S

massa jobb

men nu äre nästan klart..
städat massa idag, lr ja en del
chillat lite imellanåt men d räknar ja inte me xD
måste ju ha allt klart eftersom vi draar imån..
ja längatr 7kt mkt!

Väntar på Eve..
Ska rida Harry o Dröm när hon rider Jacky o Jerry
sen fixa stallet
o sen ja, sova ;)
Hon stannar o sover över, åker me t falsterbo imån
sen sover hon kvar här t fredag me,vi sticker kl.06.00
yepp, d blir tidigt nu, men t helgen får ja vila ut (a)


/Erika

Life is a mystery...

finns d ju folk som säger.. men ja tkr ja har en ganska klar bild av hur d är...

great!

/Erika

yepp yepp

haft en grymt härlig dag, inte
packat ur grejjer från tävlinge
packat väska
städat rum
städat hus
skurat
dammsugit huset

nu äre bara 1000000x mer saker kvar
Jippie

Hoppas ni har en roligare dag?

/Erika


packat....

o klart...

/Erika

Nu drar ja ut me båten......

...... Och jobbar på brännan! Ha de gött! //emma'S

morning

Drar ut t stallet
fixar lite,packar lite,städar lite...
lite grejer som måste vara done innan tomorrow
så bäst att ja jobbar på

see ya

/Erika


Underbar bild på Jag+Jerry o Eve+Saknad Maja<3

sussar nue

nu drar ja mej..
måste sussa lite..
fixat massa inför helgen
blir en del kan ja säga...

imån blire massa att göra..
fixa stall,packa,skriva,städa
pust*

jobbajobbajobba

men, sen får man ju ut en del för bördan oxå
torsdag, FALSTERBO!
läängar
fre-måndag, NICEE!

gaaah va bra d är

Go'natt
/Erika

Vovve buus

Kört agility med Ozzy idag, Shit va ja älskar min lilla vovvsi! Han e så duktig o arbetsvillig! Hoppa högt som fan kan han oxå, trots att han e så liten! Han va super duktig. Så vi har haft en bra dag ;-) o nu ligger han på min mage o sover! I morn hoppas ja på toppen väder så ja kan steeeka! Men de finns ett problem här borta! Jag saknar min lilla ponyyy! men Lisa rider han ibland så han har halft sommarlov! Han måste ju va i form tills VARBERGSHOPPET! Shit taggataggataggatagga!! Ska fasen Få riktiga fina o bra rundor! få den dära 'känslan'. O Erika är ju där o då kan hon kaanske hjälpa mej om ja har tur (A) fikus rockar!<3 Hahahaha xD åker hem torsdag vid lunch, sen lite senare åker ja o min mammi te Skåne! Bor hos släkt över nätterna o falsterbooo on the days! Tagga! Kommer bli as Najs. Wish You all Good. // Emma'S

chacha

Tjena
nu har alla åkt
ja, alla förutom Eve, hon hänger sej kvar xD

fixat headern lite oxå som ni kanske ser...
nice?

hängt på stranden en stund förut me alla cheyerna
grymt kul´...
nu blire lite fix inför resan o lite mer stall för min del

va gör ni?

/Erika


ny grej?

jag tänkte att vi kunde börja med "veckans blogg" ? Då får ni chansen att få en länkning och får höra  vad vi tycker om era bloggar! Det skulle väl vara roligt? :)

Tänkte att vi börjar med det nästa vecka! Då jag har fullt upp nu o snart sticker till falsterbo!

Ni kan 'anmäla' er redan nu, genom att kommentera detta inlägg med eran bloggadress, så kommer vi att kolla igenom ALLA bloggar. Och välja den som vi tycker ska få en länk här.. O vem vet? vi kanske länkar mer än 1 blogg!
Så kom igen nu o skriv era fina bloggadresser.



//Emma & Erika


yupp uppe me tuppen...

...som har försovit sej.. för klockan är 09.30 xD
men vem orkar gå upp tidigt om man inte måste? ;D
dagen spenderas me cheyerna, mina cheyer..
blir la till att rida lite sen..
o maby bada?
Who knows?
jajaja får se va dagen tar oss, spelar ingen roll.. för kul d har vi

va gör ni en sån här fin dag?


sommar bild me mina saknade älskade Emma<3

Erika Enderyd

remember

da GÄSTBLOGGING thing!
skicka eran GÄSTBLOGGNING till Berggren.wenderyd@telia.com
vi väljer ut d bästa o publicerar d när ja är i soliga frankrike!

så sätt er ner o skriv vetja!

/Erika W

Härligt!

Precis ätit lunch på bryggan ! Med andra ord har jag det bra. Hoppas ni oxå har det! Ska sedan gå o bada med hunden! Puss o kram Emma

next stop

is in Varberg..
Varbergshoppet..
Ska dock inte tävla själva "cupen", men ja ska bo där me Eve eftersom hon ska hoppa
Jacky där..
så är där o hjälper henne under torsdag-lördag o bor me dom i lastbilen :D
Sen kör vi hem lastbilen o Jacky o hämtar Drömmis,Harry o Khairo o åker tbax..
sen hoppar ja uppvärmning lör o ridsport ponny cup på sön..
riktigt taggad!

kmr nån av ER att vara där under VARBERGSHOPPET?

en bild på Eve o Jacky bara för att dom är så sjukt fina

Kram
Erikish xd

Carolyn LA Vingåker


/Erika

såhär är d

d finns en person ja tänker på..
En person ja gillar..
En person ja vill skratta me..
En person ja vill vara me..
En person ja vill h nära mej..

Ska ja våga chansa?

/Erika

fin dag asså

Ville bara säga hej..
så ah, Hej xD
lägger hela dagen me mina fina cheyer, o om ni frågar mej så äre great!
kmr mer update later on, I promise!

/Erika Wenderyd


Khairo msv B debut Vingåker


Komentera gärna va ni tycker!

/Erika

nu kmr d, woop woop

Filmerna på väg in i datorn..
kmr starta med att lägga in LA me Carro o Msv B me Khairo..
sen kmr d komma upp fler filmer
under veckan..
eftersom ja kmr vara borta
så kika in lite då o då så kmr d mer skojjsigt xD

---------------------------

Nu äre morning time
ja är la sådär halvvaken men va gör d?:p
ska ta o dra på mej lite kläder sen bär d av me mammi
t Borås o lite shopping
fett nice

sen hem igen,rida Khairo o göra iordning lite här..
så att d är nice när cheyerna kmr

hur ser eran dag ut?


tar o bjuder på denna från mina små år.. enjoy it

/Erika

d är dej ja vill ha


du är perfection för mej<3

ojojojoj va trött jag är

Hemma, äntligen!
helt sjukligt trött!
lång helg me sena kvällar o tidiga mornar... o 4 hästar va rätt mkt...
så inatt ska ja banneme vila upp mej xD

veckan är fullproppad:
Måndag: Borås me mammi,rida 2-3 hästar.. sen kmr Elin,Michelle,Eve o Paulina me hästar o sover här :D

Tisdag: Yepp, cheyerna är här hela dagen

Onsdag: massa packa,rida o såklart bloggbloggblogg

Torsdag: Falsterbo, on da evening it's paartyy

Fredag: Upp o hoppa tidigt, sen iväg till flyget o sen bär d av t Frankrike!!

Lördag: France

Söndag: France

yepp min vecka är rätt full! ;D

btw ska NI till Falsterbo? isf vilka dagar?

/Erika



Den dära saken ni vet

Ni glömmer väl inte GÄSTBLOGGNINGEN? Skicka erat bidrag till Berggren.Wenderyd@Telia.com, innan onsdag... Vi väljer ut d bästa o publiserar när jag är i frankrike.. So come on! /Erika

Lyckan tar över

Drömmis... Lilla underbara Drömmis, hoppade super i Msv B nu idag! Fick tyvärr 4 fel pga att han halkade undan med bakbenen, inget nån av oss kunde hjälpa... Men så fin han var,så fin som han alltid är! O sen så debuterade ja Khairo... Oooo jag blir helt bubbligt glad bara jag tänker på d! Helt amazing va han!! D va ingen lätt bana,nej nej.... Men så galet fint han hoppa! Ååh,behöver ja säga hur mkt ja älskar honom? Nollade allt, förutom... ETTAN-.-" ett riktigt skit nedslag,han va i bommen super lite,o den rulla sakta ner.. Men resten av banan va han klockren! O ja LOVAR imorgon ska jag FÖRSÖKA lägga in filmer! O såklart hans debut i msv B kmr upp me isf!... Sitter nu i lastbilen... En riktigt dryg resa framför mej,Woop Woop....hemma runt tolv.. Kram /Erika

Varm Dag!

Jisses vilken varm dag!¨
Vi har bara slappat hela förmiddagen!
Men jag och mammi åkte till Torp o kolla lite. Vilket resu´lterade i lite shopping såklart ;)
Jag köpte mej en bikini, en enskild bikini överdel, o mjuka shorts. Mamma köpte ett par jätte fina skor! o sen käka vi glass :P gott!
I morgon har ja inte en aning om vad som väntar här in the lovely stuga....
Kanske om de e fint väder åka ut me båten?
Eller bara sooooola! *I like*

Nu ska ja ta o va ute en stund medans man fortfarande kan bli brun!;)


ha de gött så höres vi later on !

// Emma




Va säger ni?

Vill ni att ja ska FÖRSÖKA lägga upp filmer från denna helgen i Vingåker? LA+5 me Khairo,LA me Dröm,LB me Harry o LA me Carro osv? Såklart nåra filmer till men d är iaf nåra av dom... O när ja kmr hem nu så kmr d lovade videoinlägget som krånglade... KOMENTERA om ni vill ha filmer, xoxo(lr är d så man säger?) /Erika

Rätt tjatigt men...

D blir ju en del tråkiga resultatinlägg... Men ja vet inte,ni kanske är lite nyfikna? Skriver ifall att xDigår då.. Skrev ju Harry men sen e d ju resten ;) Carro; 0/4 fel i 1.10,Drömmis; LA 0 fel o 5:a, LA+5 0 fel o 3:a.. Amazing! Khairo;LA+5... 0 fel! Goosh va fin han va! Helt galet! Så ja,som ni redan vet.. Nu blire msv B me båda /Erika

Då vare dax igen

Ny dag,nya chanser... Nu taggar ja msv B me dröm o Khairo.... Yepp debut.. Woopwoop /Erika

Hello!

Nu har jag en liten stund över, o den lägger jag på er såklart! Idag har det inte hänt ¨så jätte mycket! Nästan hela dagen har det varit mulet med lite blåst och kvav luft, så de va super varmt! Men jag o lilla vovven tog en lång promenad, o sen gick vi te badberget , de va lite kallt i vattnet så vi doppade bara tassarna ;) och satte oss på klipporna vid havet o bara myste :) jag satt ner o han låg brevid mej<3 älskar ozzy massa<3
O nu på kvällen/Sen eftermiddag har det spruckit upp så solen har skinit :)  Ska snart ta o gå ut igen, med vovven då alltså. I morgon ska vi ha liten shoppar dag! Tror vi åker till Lottas Lada, och även Torp.
För de skulle nog inte va så jätte bra väder :/ Men ja kan ju säga att jag har fått lite färg iaf :D



Jag o Amanda <33



//Emma

''''

Ja, som ni vet nu så drar ja mej till solens land nästa vecka..
o då kmr ja inte kunna blogga under 4 dagar..
så då tänkte ja såhär:

Att NI kan skicka in en GÄSTBLOGGNING till oss....
vi kmr att välja ut nåra st som vi tkr låter intressanta o som skriver bra..
d bästa bidragen kmr att läggas upp här på bloggen under d fyra dagar som ja e borta..
låter d bra?

ni kan börja skicka in redan NU
Skicka mejlet till Berggren.wenderyd@telia.com
märk mejlet me GÄSTBLOGGNING
bidraget måste vara inne senast onsdag..

soo let´s gästblogga!


/Erika

Ajajajajajajajajajajajja

Mitt ben vill inte... Värker,kan inte gå o ja,rida är pretty hard kan ja ju säga.....men på nått sätt så hoppade ja ändå Harry.. Kändes bra(förutom benet då) han va pigg,fräsh o framåt!tyvärr fick vi ett nedslag.. Ganska onödigt egentligen men d viktiga är att han känns bra! Har gått o lagt mej i lastbilen,helt slut! Orkar knappt sitta upp xD men får la snart ta o dra mej t stallet snart.. Ska ju hoppa Carro me.. Wish me luck! Hörs later On! /Erika

Krash boom bang

Jaha.. Sitter i lastbilen.. Har precis haltat mej hit o bandagerat benet... Ajajajaj.... Ni kanse vill veta vad som Hänt? jo, d va såhär att ja skrittade in på framhoppningen inför LA me Carro..hon kändes bra,lite trött men bra. Börjar hoppafram på räcket.. Hinner hoppa d två ggr.. Sen när ja rider på långsidan för att komma igen så möter vi en häst, som blir rädd o hoppar,verkligen HOPPAR in i ridbanan... PÅ mej o Carro... Mitt ben bli klämt mellan hästarna.. Ingen liten smäll utan rejält. Efterso Oxern stig gämte så kom inte Carro undan, utan hon var tvungen att stå kvar... Jag tappar balansen o hänger på sidan.. Försökte hålla mej kvar men fick tillslut släppa taget, så ja trilla av... Oooo kunde inte röra lr stödja på benet.. 3starter kvar tills vi skulle gå in i våran andra 1.20... O där satt ja o grät me ett klämt ben o en rädd häst, Jippie! Vi fick lov att flytta ner starten så d gjorde vi.. Fick sitta ner o kyla ner benet.. Men fick tillslut skita i d o hoppa upp endå, hade ju inte behövt att rida men ja ville gärna göra ett försök iaf! Men när ja sitter upp på Carro o ska rida in på framhoppningen så vägrar hon gå in.. Hon va så rädd att hon skaka min stackars häst<3 så vi skrittade utanför, senkom vi in på framhoppningen tillslut i lyckades ta två språng på räcket,hon vågade inte gå nära Oxern igen.. O hon va jätte rädd för ALLA hästar runt om.. Gick in på banan me. Noll förutsättningar.. O hoppar våra. Andra LA me ett skit nedslag på näst sista hindret, B hindret i kombinationen.. Blev lite trång så vi rev.. Helt GRYM häst ja har!!! dockr hon väldigt chockad över händelsen fortfarande min älskling, men hon står nu lugnt i boxen o tuggar hö o smälter allt som hänt.. Kra /Erika

Kan ju inte säga annat...

Än att d går BRA här i Vingåker... 11 starter 6 placeringar.... O detta för att mina hästar,ja va ska ja säga? Dom ÄR helt amazing helt enkelt... Hoppade Drömmis o Khairo nu i LA.. Drömmis nolla o 4:à Khairo nolla o 3:a.. Sjukt nöjd chey! Nu TAGGAR vi Carro i LA! /Erika

värme

om EXAKT en vecka ligger ja i en solstol i Frankrike..
grr va härligt d kmr bli!
sola massa, för brun d ska ja bli! bada i havet, äta på restaurang, o såklart shoppa lite
längtar galet mkt!

kmr bo i Nice, på ett fett nice(hihi namnet*) hotell me pool på taket o grym frukost buffé!
yammi

åker på fredag morgon..
kmr fram på dagen/Eftermiddagen i Nice, sen e d bara till att enjoy it!
kmr hem på måndag igen..
som ni förstår så kmr ja inte kunna blogga under d dagarna..
men ja har lite planer för hur d ska lösas..


/Erika

Bara 3 till

Hoppat Harry o Carro.... O värmen håller sej kvar, mmh va härligt!-.- jajaja hur som helst så va Harry finfinfin idag! Hoppade LB(för att han ska komma igång) o va dubbelnolla o 8:a! O Carro hoppade 1.10... Fin,super fin faktiskt men tyvärr så fick vi ett SKIT pet, o då menar ja verkligen PET!.. Jaja fin va hon iaf.. O nu Laddar ja inför LA me Dröm,kaka o Carro... Va gör nk idag? kram Erika från landet ingenstans

LÄNGTAAAR!

Nu ska ni få veta en sak som lilla emma längtar till som faaaaaasen!

FALSTERBO!

Ska bli så j*vla roligt asså, o ett STORT + i kanten är ju att ja får träffa mina fina Amanda Claesson och Julide Yoldas<3

Saknar de galningarna som fan asså!

bara 8 dagar kvar idag..! ;)

JAG är där fredag-Lördag, ska NI dit??

Isf; Vilka dagar?


Ha de bäääst!




//Emma


<3

Mitt hjärta slår för dig, <3




Sötnoooooos!




//Emma


hej igen!

nu va det länge sen, men jag är ju i stugan och har inte jätte mkt tid att lägga på datorn o bloggen...
Kan ju bara berätta att det har varit ca 38 grader på vår altan hääär...... *puh* ! Det vart liite jobbigt då det inte blåste ngt heller! :O Men vi har gått ner te badberget o badat i havet ist! Med min lilla voovve<3 han tycker de e suuper kul ! 
Kan inte ladda upp alla bilder från AW då ja inte har med mej min dator.. utan de får duga med dessa så länge bara :)  








Bättre än inget , right? ;)


/Emma


RSS 2.0